GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2025-10-27 02:20:10, GGGenome : RefSeq human RNA (XM/XR) release 200 (May, 2020)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

PREDICTED: Homo sapiens membrane associated guanylate kinase, WW and PDZ domain containing 2 (MAGI2), transcript variant X10, mRNA
XM_011516720.3:3456-3470
TATATTTGTTATAGAATATTATGTTAAATC3456TTCATTGACAACATTAAAGAGTCATACCTTTTATGGGTGTTAGTT
PREDICTED: Homo sapiens membrane associated guanylate kinase, WW and PDZ domain containing 2 (MAGI2), transcript variant X12, mRNA
XM_017012847.2:3456-3470
TATATTTGTTATAGAATATTATGTTAAATC3456TTCATTGACAACATTAAAGAGTCATACCTTTTATGGGTGTTAGTT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : https://gggenome.dbcls.jp/hsxm_refseq200/TTCATTGACAACATT
lang : en | db : hsxm_refseq200 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.009 | 0.009 | search_start;
0.081 | 0.072 | search_plus_done; http://172.18.8.75:28838/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.085 | 0.004 | search_minus_done; http://172.18.8.75:28838/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=48
0.085 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).