GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2024-02-24 04:17:36, GGGenome : RefSeq human RNA (XM/XR) release 220 (Sep, 2023)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

PREDICTED: Homo sapiens membrane associated guanylate kinase, WW and PDZ domain containing 2 (MAGI2), transcript variant X11, mRNA
XM_011516720.4:40090-40104
TATATTTGTTATAGAATATTATGTTAAATC40090TTCATTGACAACATTAAAGAGTCATACCTTTTATGGGTGTTAGTT
PREDICTED: Homo sapiens membrane associated guanylate kinase, WW and PDZ domain containing 2 (MAGI2), transcript variant X12, mRNA
XM_017012847.3:40090-40104
TATATTTGTTATAGAATATTATGTTAAATC40090TTCATTGACAACATTAAAGAGTCATACCTTTTATGGGTGTTAGTT
PREDICTED: Homo sapiens membrane associated guanylate kinase, WW and PDZ domain containing 2 (MAGI2), transcript variant X11, mRNA
XM_054359445.1:40148-40162
TATATTTGTTATAGAATATTATGTTAAATC40148TTCATTGACAACATTAAAGAGTCATACCTTTTATGGGTGTTAGTT
PREDICTED: Homo sapiens membrane associated guanylate kinase, WW and PDZ domain containing 2 (MAGI2), transcript variant X12, mRNA
XM_054359446.1:40148-40162
TATATTTGTTATAGAATATTATGTTAAATC40148TTCATTGACAACATTAAAGAGTCATACCTTTTATGGGTGTTAGTT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/hsxm_refseq220/TTCATTGACAACATT
lang : en | db : hsxm_refseq220 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.009 | 0.009 | search_start;
0.083 | 0.075 | search_plus_done; http://172.18.8.75:28960/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.090 | 0.007 | search_minus_done; http://172.18.8.75:28960/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=46
0.090 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).