GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-04 11:30:03, GGGenome : Ichthyophthirius multifiliis macronuclear genome

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr2863
position: 20563-20577
AACTAGTTTGGAGCACCTTTGGTATTAAAA20563AATGTTGTCAATGAATATAGAATCGATGAAAATGAAATTATACTC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/img1/TTCATTGACAACATT
lang : en | db : img1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.078 | 0.071 | search_plus_done; http://172.18.8.72:28252/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.081 | 0.004 | search_minus_done; http://172.18.8.72:28252/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=50
0.082 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).