GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2025-10-27 16:12:20, GGGenome : Marmoset spliced RNA, TRaC 20.03 protein coding on calJacRKC1912, D3G 20.03 (Mar, 2020)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

ENSCJAG00000014861;TRaC2003L1a84b|MIR4785|chr6:92541779:92607037:-|spliced
position: 1184-1198
AAGTTCCAAAGTAAATTTGCATTATATGCT1184AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT
ENSCJAG00000014861;TRaC2003L1a84c|RBMS1|chr6:92557172:92686106:-|spliced
position: 1297-1311
AAGTTCCAAAGTAAATTTGCATTATATGCT1297AATGTTGTCAATGAATAGAATATAAATGTGCTACTTTGCTGCAAT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : https://gggenome.dbcls.jp/en/calJacRKC1912_Trac2003ProtCoding_spliced_d3g2003/TTCATTGACAACATT
lang : en | db : calJacRKC1912_Trac2003ProtCoding_spliced_d3g2003 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.010 | 0.010 | search_start;
0.088 | 0.078 | search_plus_done; http://172.18.8.75:28814/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.092 | 0.004 | search_minus_done; http://172.18.8.75:28814/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=50
0.094 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).