GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2025-10-26 09:52:42, GGGenome : Ciona intestinalis genome, JGI 2.1/ci2 (Mar, 2005)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr03q:1519269-1519283
ATAAATTAGAACTTATAAAAGTTATTAATA1519269AATGTTGTCAATGAACCACCTATGTTAAATACAAACCTAAAACGT
chr01q:1233788-1233802
AGCACTATTCCACTTTCTATACTTGCGTTT1233788TTCATTGACAACATTAATGTGATGCGGTGTCATCTCATCATGCCC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : https://gggenome.dbcls.jp/en/ci2/AATGTTGTCAATGAA
lang : en | db : ci2 | k : 0 | strand : | nogap : | query_string : AATGTTGTCAATGAA | format : html | download : | debug :

0.009 | 0.009 | search_start;
0.079 | 0.070 | search_plus_done; http://172.18.8.76:28090/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=50
0.082 | 0.003 | search_minus_done; http://172.18.8.76:28090/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=49
0.082 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).