GGGenome | Results

2025-04-09 14:12:29, GGGenome : DDBJ release 134.0 (Mar, 2024)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and in~~dels~~ are marked in red.

RCRB479TP Castor bean cDNA library from roots, 1.8 kb Ricinus communis cDNA clone RCRB479, mRNA sequence.
EG686478.1:73-94

AATTAAAAATAAAAGAATTGGGAGAGTCCA73GTCCAGGTTCACCATCTTGATTCCACTGCCTCGCCGCTCCATAAATACCCCC

RCSAS56TP Castor bean cDNA library from seeds (12-33 days after pollination), 1.4 kb Ricinus communis cDNA clone RCSAS56, mRNA sequence.
EG692399.1:47-68

AATTAAAAATAAAAGAATTGGGAGAGTCCA47GTCCAGGTTCACCATCTTGATTCCACTGCCTCGCCGCTCCATAAATACCCCC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Tab-delimited text: Open in new window | Download
You can copy-paste the result into spreadsheet softwares (e.g. Excel) or text editors.
CSV format: Open in new window | Download
You can open CSV files using spreadsheet softwares (e.g. Excel) or text editors.
BED format: Link | Download
GFF format: Link | Download
JSON format: Link | Download

Debug Info:

0.009 | 0.009 | search_start;
0.204 | 0.196 | search_plus_done; http://172.18.8.135:50400/match?q=GTCCAGGTTCACCATCTTGATT&k=0&no_gap=0&offset=0&limit=50
0.233 | 0.028 | search_minus_done; http://172.18.8.135:50400/match?q=AATCAAGATGGTGAACCTGGAC&k=0&no_gap=0&offset=0&limit=48
0.233 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).