GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2025-10-26 22:30:14, GGGenome : Atlantic cod genome, Genofisk GadMor_May2010/gadMor1 (May, 2010)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

HE569754:1552942-1552956
AGTCTGAGCTCAGGGTTGAAAAAACGCTTT1552942TTCATTGACAACATTTCACAGGTGGTTACAAAATTGCATCAAAAA
HE566070:105735-105749
AGTATTTAAATATGGACATTTCTTTACCTT105735TTCATTGACAACATTCTGTTGTTATTGTGTCAAACCAACTTTCGC
HE566665:813075-813089
TGGGACCGTGGGGGCCCCTTCGATGGGTCT813075TTCATTGACAACATTGGCCGTGCGCCAAGGGCTAGGGGGAAATCT
HE566701:1533751-1533765
ATAGATAGCACACATAAATCTTTCATTATT1533751TTCATTGACAACATTTGGGGCTAATGCAAGACTACAGTTATACAA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : https://gggenome.dbcls.jp/en/gadMor1/TTCATTGACAACATT
lang : en | db : gadMor1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.010 | 0.010 | search_start;
0.083 | 0.073 | search_plus_done; http://172.18.8.76:28070/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.087 | 0.004 | search_minus_done; http://172.18.8.76:28070/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=46
0.087 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).