GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-04 11:15:57, GGGenome : Lotus japonicus genome, build 3.0 (Aug, 2015)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Lj3.0_chr1 Chr1
position: 53194554-53194568
TAACATAAAAGGGTAAAGTATAAATACGTG53194554TTCATTGACAACATTTTCATCCTCTCTTCTAAGCCTGTTTTACTC
Lj3.0_chr2 Chr2
position: 28126950-28126964
AGCTGCTGCACAGAATCATCAAGATGTTGC28126950TTCATTGACAACATTTCAGCTTCTGCTTTCTCCCATCCTTCAAAG
Lj3.0_chr2 Chr2
position: 30850794-30850808
GAAAACTCATTATACTCGCATGAAAAATGT30850794TTCATTGACAACATTCCCACCACCACCTTAAAGAGATCAGAATAT
Lj3.0_chr0 Chr0
position: 61918763-61918777
AGACCATTCTTGGAGAAGTTTGCGGTTGTG61918763TTCATTGACAACATTCTGATTTACTCGAAGAGTAAGGAAGAACAT
Lj3.0_chr0 Chr0
position: 152303994-152304008
AGAATGATACTCAAACATATGCAACATGAG152303994TTCATTGACAACATTCAATTAAATACTTGTAAAACATGGAATTTC
Lj3.0_chr1 Chr1
position: 1928184-1928198
GAAATTCCATGTTTTACAAGTATTTAATTG1928184AATGTTGTCAATGAACTCATGTTGCATATGTTTGAGTATCATTCT
Lj3.0_chr1 Chr1
position: 7112398-7112412
ATATAGAGCCAAGTTTCTCCTGTAATTAAG7112398AATGTTGTCAATGAATAAATTTTTCAAGGAAACTTCTATTATAAA
Lj3.0_chr2 Chr2
position: 6412591-6412605
TCTAAGGTTATGGTATTCAATTGCCTCTGT6412591AATGTTGTCAATGAAGAGTGTGATGCAAGACAAGACCGCTCCTTT
Lj3.0_chr6 Chr6
position: 21135906-21135920
ATATAGAGCCAAGTTTCTCCTGTAATTAAG21135906AATGTTGTCAATGAATAAATTTTTCAAGGAAACTTCTATTATAAA
Lj3.0_chr0 Chr0
position: 34543462-34543476
CCCGGTTCACGGAAAGAACAGAAGGAAACC34543462AATGTTGTCAATGAAGGTGGATTCTGCTACGTGGGAGGTCATGGC
Lj3.0_chr0 Chr0
position: 188239518-188239532
TCTAAGGTTATGGTATTCAATTGCCTCTGT188239518AATGTTGTCAATGAAGAGTGTGATGCAAGACAAGACCGCTCCTTT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/lotus_r3.0/TTCATTGACAACATT
lang : en | db : lotus_r3.0 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.086 | 0.079 | search_plus_done; http://172.18.8.77:28236/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.098 | 0.012 | search_minus_done; http://172.18.8.77:28236/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=45
0.101 | 0.003 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).