GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-03-05 23:12:04, GGGenome : Elephant genome, Broad/loxAfr3 (Jul, 2009)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

scaffold_6:4076852-4076866
TGACAACAATCTTCTGTGATCTGTAGGGTT4076852TTCATTGACAACATTTTAGAAGTAGATAGCTAGGCATTTCTTCCT
scaffold_6:7220217-7220231
GAAAAAATATTCAAAGAGGTGCCTTTATTC7220217TTCATTGACAACATTTCCATGTATCTTCAGCTAAATGGTGTTCCT
scaffold_8:74631792-74631806
GTTTCCATTCAACAGTCTCTACACAAATTG74631792TTCATTGACAACATTCTCATTATCTCCAATCTAGATGTCCCATTA
scaffold_12:10006880-10006894
AGTATGCTGAACTCCAAATACTATTGTGTT10006880TTCATTGACAACATTCACTGTTCATATGCATATGAAAAACAGGCA
scaffold_15:54811308-54811322
AACTGTGAAACCCTCAAGAATCTCTGGTAA54811308TTCATTGACAACATTCACTTATTTGTATTGATCTTTTCTTTTATG
scaffold_28:14825424-14825438
TAAATGAGGAGTGGGCACATATTTAACCAA14825424TTCATTGACAACATTTTTGGAACCCCTACTATGTTCTGCAGACTG
scaffold_74:6268806-6268820
ATCACACACACACACACACACACATATATA6268806TTCATTGACAACATTTGGTACTATTTTCTGTATTTAAAAATTTTA
scaffold_1:15930986-15931000
GAACAGTGGAAACGAGCTATGGATTATTTA15930986AATGTTGTCAATGAACTCAACTACATGACTCAGATTGTTATCATG
scaffold_4:64410412-64410426
CACCAGAGCTCCGATTCTTAGGGGTGTTTA64410412AATGTTGTCAATGAAAGGTAAAGTTCCCCTTAACACAACTTTAAT
scaffold_5:85747362-85747376
AGATCCATAAAGAAGAAAAAGACACTTAAG85747362AATGTTGTCAATGAAGTTTTTCCAACTATGGTCTCTTTCAAATAT
scaffold_22:25997382-25997396
TCTCGTGTAGTAATATTTTAATGTATACAG25997382AATGTTGTCAATGAAAATTACAGAGCCTCATAATTTGGTTTTGCG
scaffold_23:8394111-8394125
GACACGGTAGTTCCAAGTATTGAGATGCAG8394111AATGTTGTCAATGAAACAGCTTTATTGAAGCGAAGCAGTGGTGGG
scaffold_31:14443886-14443900
ATATAATACAAGAAGTTTTGACTGAAATGC14443886AATGTTGTCAATGAACATGTTTATTATTGAACATTCAACCTAAAT
scaffold_51:8147674-8147688
TTAAAACTAATATTAAATGGATACCCACGA8147674AATGTTGTCAATGAAAATCTGTGTTTAAAGTGATAATATATTCTA
scaffold_66:7338278-7338292
ATCCAACCTGTTCTTCGGAGAAATCTGGAA7338278AATGTTGTCAATGAATAAAAAACAACAAATATGAATGATAAAACC
scaffold_106:3412789-3412803
CGACCATCCCAATTATCCCAGGACTGCATT3412789AATGTTGTCAATGAATGTCTTATGTCCTGGGAAACACCTCGATCC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/loxAfr3/TTCATTGACAACATT
lang : en | db : loxAfr3 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.079 | 0.072 | search_plus_done; http://172.18.8.78:28032/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.085 | 0.005 | search_minus_done; http://172.18.8.78:28032/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=43
0.086 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).