GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-12-08 06:45:15, GGGenome : Wallaby genome, TWGS Meug_1.1/macEug2 (Sep, 2009)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

GL061700:2071-2085
CATGATAACAATCTGAGTCATGTAGTTGAG2071TTCATTGACAACATTCAGATAATCCATGGCGCGCTTCCACTGATC
GL084244:9306-9320
GGTCGTGGTGTGAGGGCTATAAAGAGTGAA9306TTCATTGACAACATTCTAATGTTTTTCAGTGATAAAACAAAACAG
GL111509:5082-5096
TGCAAGCTTGATCTTTAGTATTCTTACTTA5082TTCATTGACAACATTTCACTGAGAAATCAGTAATATATGTTAGTG
GL121124:8014-8028
TGAGTTTAGAAAGCCTGTGCTTTCATAATA8014TTCATTGACAACATTTGTTTCTATCCTTCTTTATACCTTAGCATA
GL130977:4632-4646
GCTTAGCACACAGTAGGTACTTGATTAATA4632TTCATTGACAACATTTATCTTCAATCAAAAAGCATTTATTAAACA
GL049702:13260-13274
AATAAGGATGTCGTATTCCATGGAATATGG13260AATGTTGTCAATGAAAAATTCCAAATAGGCTCCCTCGGGTACTCT
GL068266:14228-14242
CAGTCATACCTGTAGTATCTGCCTGACAAA14228AATGTTGTCAATGAAGTTAGGATCCTACATCTAGAGCTGGAAAGA
GL081147:26923-26937
GTGCTCAGTTACTGGCAGCCCATTTTAAGG26923AATGTTGTCAATGAACTGGTATGAGGATAACAAAGATGTGAGAGG
GL088638:29618-29632
TCTCAGAAAAGACCCCTGTGGAGGATCTGG29618AATGTTGTCAATGAAAAATAAGAGAGGCGTATAATTATATGATAC
GL131386:97415-97429
TGCCCTAAGAAATAGGGAACTGACCTAGGA97415AATGTTGTCAATGAACTCTGTTGACTCAAATCATCACCACCAATA
GL131818:265-279
TTTCTGTGCCAAAGGTGACTGATCCCTGAA265AATGTTGTCAATGAACTAGTCATAGATAATAAGGCTTTAATGACA
GL139502:28763-28777
GGAATGATATGCTCACATATGTTTTTTTTA28763AATGTTGTCAATGAATGTACCCACTTTCACCTACAATGTACAAAG
GL149922:59582-59596
CACCCCCTAGTAACTACCTCATACGTAAAG59582AATGTTGTCAATGAAAAAAGTTATCTTATTAACTCTAAGTGTGAG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/macEug2/TTCATTGACAACATT
lang : en | db : macEug2 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.081 | 0.073 | search_plus_done; http://172.18.8.77:28067/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.086 | 0.006 | search_minus_done; http://172.18.8.77:28067/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=45
0.088 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).