GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-08-15 00:02:51, GGGenome : Crab-eating macaque pre-spliced RNA, TRaC 20.03 on macFasRKS1912, D3G 20.03 (Mar, 2020)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

ENSMFAG00000042405;TRaC2003L15969|AC005838.1|chr16:63421341:63563178:-|prespliced
position: 27233-27247
GCCTCTGGGCCTATATTAGATGGGCCATGC27233TTCATTGACAACATTGATTTTATGTTTATTTGTGAAAGGGCAGAA
ENSMFAG00000042405;TRaC2003L1596b|COX10|chr16:63421467:63563178:-|prespliced
position: 27233-27247
GCCTCTGGGCCTATATTAGATGGGCCATGC27233TTCATTGACAACATTGATTTTATGTTTATTTGTGAAAGGGCAGAA
ENSMFAG00000042405;TRaC2003L1596c|AC005838.1|chr16:63421738:63563178:-|prespliced
position: 27233-27247
GCCTCTGGGCCTATATTAGATGGGCCATGC27233TTCATTGACAACATTGATTTTATGTTTATTTGTGAAAGGGCAGAA
ENSMFAG00000042405;TRaC2003L1596d|AC005838.1|chr16:63422054:63563178:-|prespliced
position: 27233-27247
GCCTCTGGGCCTATATTAGATGGGCCATGC27233TTCATTGACAACATTGATTTTATGTTTATTTGTGAAAGGGCAGAA
ENSMFAG00000042405;TRaC2003L1596e|AC005838.1|chr16:63422130:63563178:-|prespliced
position: 27233-27247
GCCTCTGGGCCTATATTAGATGGGCCATGC27233TTCATTGACAACATTGATTTTATGTTTATTTGTGAAAGGGCAGAA
ENSMFAG00000042405;TRaC2003L1596f|COX10|chr16:63422142:63563178:-|prespliced
position: 27233-27247
GCCTCTGGGCCTATATTAGATGGGCCATGC27233TTCATTGACAACATTGATTTTATGTTTATTTGTGAAAGGGCAGAA
ENSMFAG00000042405;TRaC2003L15970|AC005838.1|chr16:63422222:63563178:-|prespliced
position: 27233-27247
GCCTCTGGGCCTATATTAGATGGGCCATGC27233TTCATTGACAACATTGATTTTATGTTTATTTGTGAAAGGGCAGAA
ENSMFAG00000042405;TRaC2003L15971|AC005838.1|chr16:63423717:63563178:-|prespliced
position: 27233-27247
GCCTCTGGGCCTATATTAGATGGGCCATGC27233TTCATTGACAACATTGATTTTATGTTTATTTGTGAAAGGGCAGAA
ENSMFAG00000042405;TRaC2003L15972|AC005838.1|chr16:63438762:63563178:-|prespliced
position: 27233-27247
GCCTCTGGGCCTATATTAGATGGGCCATGC27233TTCATTGACAACATTGATTTTATGTTTATTTGTGAAAGGGCAGAA
ENSMFAG00000042405;TRaC2003L15973|AC005838.1|chr16:63438886:63563178:-|prespliced
position: 27233-27247
GCCTCTGGGCCTATATTAGATGGGCCATGC27233TTCATTGACAACATTGATTTTATGTTTATTTGTGAAAGGGCAGAA
ENSMFAG00000042405;TRaC2003L15974|COX10|chr16:63456168:63563178:-|prespliced
position: 27233-27247
GCCTCTGGGCCTATATTAGATGGGCCATGC27233TTCATTGACAACATTGATTTTATGTTTATTTGTGAAAGGGCAGAA
ENSMFAG00000042405;TRaC2003L15975|COX10|chr16:63459106:63563178:-|prespliced
position: 27233-27247
GCCTCTGGGCCTATATTAGATGGGCCATGC27233TTCATTGACAACATTGATTTTATGTTTATTTGTGAAAGGGCAGAA
ENSMFAG00000042405;TRaC2003L15976|COX10|chr16:63467476:63563178:-|prespliced
position: 27233-27247
GCCTCTGGGCCTATATTAGATGGGCCATGC27233TTCATTGACAACATTGATTTTATGTTTATTTGTGAAAGGGCAGAA
ENSMFAG00000042405;TRaC2003L15977|COX10|chr16:63471781:63563178:-|prespliced
position: 27233-27247
GCCTCTGGGCCTATATTAGATGGGCCATGC27233TTCATTGACAACATTGATTTTATGTTTATTTGTGAAAGGGCAGAA
ENSMFAG00000042405;TRaC2003L15979|COX10|chr16:63530037:63563178:-|prespliced
position: 27233-27247
GCCTCTGGGCCTATATTAGATGGGCCATGC27233TTCATTGACAACATTGATTTTATGTTTATTTGTGAAAGGGCAGAA
ENSMFAG00000042150;TRaC2003L1a43e|CYP2A7|chr19:38527395:38627053:-|prespliced
position: 37341-37355
GAGCCACCACGCCCTGCCTATCTTAGCTTT37341TTCATTGACAACATTAGTATAATGTTAACGGCTCTCCTAAGGGAG
ENSMFAG00000042150;TRaC2003L1a43e|CYP2A7|chr19:38527395:38627053:-|prespliced
position: 88246-88260
GAGCCTACCACCCCTGGCCTGTCTTAGCTT88246TTCATTGACAACATTAGTATAATGTTACAGCTCTCCTAAGGGAGT
ENSMFAG00000032459;TRaC2003L1a45e|CYP2A7|chr19:38665885:38775634:+|prespliced
position: 83068-83082
GTGAGCCACCATGCTGGCCTATCTTAGCTT83068TTCATTGACAACATTAGTATAATGTTAACAGCTCTCCTAAGGGAA
ENSMFAG00000032459;TRaC2003L1a45f|CYP2A7|chr19:38665885:38775974:+|prespliced
position: 83068-83082
GTGAGCCACCATGCTGGCCTATCTTAGCTT83068TTCATTGACAACATTAGTATAATGTTAACAGCTCTCCTAAGGGAA
na;TRaC2003L28bd4|na|chr5:176195809:178390881:+|prespliced
position: 1400030-1400044
TTTGGACCCCCAGATCAGTCTTCATATTCT1400030TTCATTGACAACATTCATGAAGTTCTGCAGAAATTAGATAGAATT
na;TRaC2003L28bd6|na|chr5:176195809:177889327:+|prespliced
position: 1400030-1400044
TTTGGACCCCCAGATCAGTCTTCATATTCT1400030TTCATTGACAACATTCATGAAGTTCTGCAGAAATTAGATAGAATT
ENSMFAG00000001427;TRaC2003L28bd7|TENM3|chr5:176195817:178948379:+|prespliced
position: 1400022-1400036
TTTGGACCCCCAGATCAGTCTTCATATTCT1400022TTCATTGACAACATTCATGAAGTTCTGCAGAAATTAGATAGAATT
ENSMFAG00000001427;TRaC2003L28bd8|TENM3|chr5:176195817:178498271:+|prespliced
position: 1400022-1400036
TTTGGACCCCCAGATCAGTCTTCATATTCT1400022TTCATTGACAACATTCATGAAGTTCTGCAGAAATTAGATAGAATT
na;TRaC2003L28bd9|na|chr5:176195817:178186630:+|prespliced
position: 1400022-1400036
TTTGGACCCCCAGATCAGTCTTCATATTCT1400022TTCATTGACAACATTCATGAAGTTCTGCAGAAATTAGATAGAATT
na;TRaC2003L28bdb|na|chr5:176195817:178186652:+|prespliced
position: 1400022-1400036
TTTGGACCCCCAGATCAGTCTTCATATTCT1400022TTCATTGACAACATTCATGAAGTTCTGCAGAAATTAGATAGAATT
ENSMFAG00000001427;TRaC2003L28bdc|TENM3|chr5:176195817:178948415:+|prespliced
position: 1400022-1400036
TTTGGACCCCCAGATCAGTCTTCATATTCT1400022TTCATTGACAACATTCATGAAGTTCTGCAGAAATTAGATAGAATT
ENSMFAG00000001427;TRaC2003L28bdd|TENM3|chr5:176195817:178948466:+|prespliced
position: 1400022-1400036
TTTGGACCCCCAGATCAGTCTTCATATTCT1400022TTCATTGACAACATTCATGAAGTTCTGCAGAAATTAGATAGAATT
ENSMFAG00000001427;TRaC2003L28bde|TENM3|chr5:176195817:178950467:+|prespliced
position: 1400022-1400036
TTTGGACCCCCAGATCAGTCTTCATATTCT1400022TTCATTGACAACATTCATGAAGTTCTGCAGAAATTAGATAGAATT
ENSMFAG00000041711;TRaC2003L28de8|F11|chr5:182380896:182407878:+|prespliced
position: 12108-12122
GCCTGAGCCACCATGCCCAGCTTGCTATTC12108TTCATTGACAACATTCACTTAAACAAACAAACATCCATAAAATTA
ENSMFAG00000003495;TRaC2003L093ed|SYT1|chr11:75751393:76346690:+|prespliced
position: 245949-245963
GTAAGATAGGTTTGTTCCAGAAGTTTAAAA245949AATGTTGTCAATGAATTTGATAAAATTTAATATTCACATTAGAAG
ENSMFAG00000003495;TRaC2003L093ee|SYT1|chr11:75752441:76106019:+|prespliced
position: 244901-244915
GTAAGATAGGTTTGTTCCAGAAGTTTAAAA244901AATGTTGTCAATGAATTTGATAAAATTTAATATTCACATTAGAAG
ENSMFAG00000003495;TRaC2003L093f0|SYT1|chr11:75752441:76346693:+|prespliced
position: 244901-244915
GTAAGATAGGTTTGTTCCAGAAGTTTAAAA244901AATGTTGTCAATGAATTTGATAAAATTTAATATTCACATTAGAAG
ENSMFAG00000003495;TRaC2003L093f1|SYT1|chr11:75752441:76346693:+|prespliced
position: 244901-244915
GTAAGATAGGTTTGTTCCAGAAGTTTAAAA244901AATGTTGTCAATGAATTTGATAAAATTTAATATTCACATTAGAAG
ENSMFAG00000003495;TRaC2003L093f2|SYT1|chr11:75752441:76346776:+|prespliced
position: 244901-244915
GTAAGATAGGTTTGTTCCAGAAGTTTAAAA244901AATGTTGTCAATGAATTTGATAAAATTTAATATTCACATTAGAAG
ENSMFAG00000003495;TRaC2003L093f3|SYT1|chr11:75752441:76346781:+|prespliced
position: 244901-244915
GTAAGATAGGTTTGTTCCAGAAGTTTAAAA244901AATGTTGTCAATGAATTTGATAAAATTTAATATTCACATTAGAAG
ENSMFAG00000003495;TRaC2003L093f4|SYT1|chr11:75752441:76180993:+|prespliced
position: 244901-244915
GTAAGATAGGTTTGTTCCAGAAGTTTAAAA244901AATGTTGTCAATGAATTTGATAAAATTTAATATTCACATTAGAAG
ENSMFAG00000003495;TRaC2003L093f5|SYT1|chr11:75752441:76105811:+|prespliced
position: 244901-244915
GTAAGATAGGTTTGTTCCAGAAGTTTAAAA244901AATGTTGTCAATGAATTTGATAAAATTTAATATTCACATTAGAAG
na;TRaC2003L1a441|na|chr19:38556252:38627040:+|prespliced
position: 33447-33461
CTCCCTTAGGAGAGCCGTTAACATTATACT33447AATGTTGTCAATGAAAAAGCTAAGATAGGCAGGGCGTGGTGGCTC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/macFasRKS1912_Trac2003_prespliced_d3g2003/TTCATTGACAACATT
lang : en | db : macFasRKS1912_Trac2003_prespliced_d3g2003 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.083 | 0.076 | search_plus_done; http://172.18.8.75:28821/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.106 | 0.022 | search_minus_done; http://172.18.8.75:28821/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=21
0.111 | 0.005 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).