GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-11-29 11:50:56, GGGenome : Crab-eating macaque genome, macFasRKS1912 (Dec, 2019)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr11
position: 75997342-75997356
GTAAGATAGGTTTGTTCCAGAAGTTTAAAA75997342AATGTTGTCAATGAATTTGATAAAATTTAATATTCACATTAGAAG
chr16
position: 63535932-63535946
TTCTGCCCTTTCACAAATAAACATAAAATC63535932AATGTTGTCAATGAAGCATGGCCCATCTAATATAGGCCCAGAGGC
chr19
position: 38538794-38538808
ACTCCCTTAGGAGAGCTGTAACATTATACT38538794AATGTTGTCAATGAAAAGCTAAGACAGGCCAGGGGTGGTAGGCTC
chr19
position: 38589699-38589713
CTCCCTTAGGAGAGCCGTTAACATTATACT38589699AATGTTGTCAATGAAAAAGCTAAGATAGGCAGGGCGTGGTGGCTC
chr2
position: 82806956-82806970
ACTATGCTGCACTCCAAATACTATTGTGTT82806956TTCATTGACAACATTCCCTATTACATATGCATATGAAAAACAGGC
chr5
position: 145177019-145177033
CAGAATATATTATCGCTTTGAACACAGATT145177019TTCATTGACAACATTTTGTGGGCATCCATTTAATATTAATATTAA
chr5
position: 162050621-162050635
TAAAACCTCTGATTTTGTGTAACACTCCTT162050621TTCATTGACAACATTAAACAGCAATTAACTATTTGCTGACTACAT
chr5
position: 177595839-177595853
TTTGGACCCCCAGATCAGTCTTCATATTCT177595839TTCATTGACAACATTCATGAAGTTCTGCAGAAATTAGATAGAATT
chr5
position: 182393004-182393018
GCCTGAGCCACCATGCCCAGCTTGCTATTC182393004TTCATTGACAACATTCACTTAAACAAACAAACATCCATAAAATTA
chr14
position: 84977922-84977936
TTGAGTTTCCAGGAACATAGATATGTCTTG84977922TTCATTGACAACATTCTAGCGTTGAGGACAGTGAATAGAGCAAAC
chr17
position: 47361899-47361913
TGTTCAAAGTTTTCCCCTCCAATGTATCTT47361899TTCATTGACAACATTCGGATTTATCACATCAATCAGTCAATAAAT
chr17
position: 64209427-64209441
GCAGTCTGGAGGTTCTCCCTGGAGGCTGTA64209427TTCATTGACAACATTGCCTGAGGTAACTCACACTGAGGTGACAAC
chr19
position: 38748953-38748967
GTGAGCCACCATGCTGGCCTATCTTAGCTT38748953TTCATTGACAACATTAGTATAATGTTAACAGCTCTCCTAAGGGAA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/macFasRKS1912_chrM_d3g2101/AATGTTGTCAATGAA
lang : en | db : macFasRKS1912_chrM_d3g2101 | k : 0 | strand : | nogap : | query_string : AATGTTGTCAATGAA | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.077 | 0.070 | search_plus_done; http://172.18.8.75:28825/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=50
0.082 | 0.005 | search_minus_done; http://172.18.8.75:28825/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=46
0.088 | 0.006 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).