GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2022-08-15 09:56:41, GGGenome : Crab-eating macaque pre-spliced RNA, RefSeq on macFasRKS1912v2, D3G 22.02 (Feb, 2022)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

XM_015430622.2|SYT1;101865424|chr11:75699198:76293064:+|prespliced::chr11:75699198-76293064(+)
position: 244757-244771
GTAAGATAGGTTTGTTCCAGAAGTTTAAAA244757AATGTTGTCAATGAATTTGATAAAATTTAATATTCACATTAGAAG
XM_015430624.2|SYT1;101865424|chr11:75699198:76293064:+|prespliced::chr11:75699198-76293064(+)
position: 244757-244771
GTAAGATAGGTTTGTTCCAGAAGTTTAAAA244757AATGTTGTCAATGAATTTGATAAAATTTAATATTCACATTAGAAG
XM_015430625.2|SYT1;101865424|chr11:75699198:76293064:+|prespliced::chr11:75699198-76293064(+)
position: 244757-244771
GTAAGATAGGTTTGTTCCAGAAGTTTAAAA244757AATGTTGTCAATGAATTTGATAAAATTTAATATTCACATTAGAAG
XM_015430626.2|SYT1;101865424|chr11:75699198:76293064:+|prespliced::chr11:75699198-76293064(+)
position: 244757-244771
GTAAGATAGGTTTGTTCCAGAAGTTTAAAA244757AATGTTGTCAATGAATTTGATAAAATTTAATATTCACATTAGAAG
XM_045366611.1|SYT1;101865424|chr11:75699198:76293064:+|prespliced::chr11:75699198-76293064(+)
position: 244757-244771
GTAAGATAGGTTTGTTCCAGAAGTTTAAAA244757AATGTTGTCAATGAATTTGATAAAATTTAATATTCACATTAGAAG
XM_045379572.1|CYP2G2;102125069|chr19:38697275:38711143:-|prespliced::chr19:38697275-38711143(-)
position: 1949-1963
TTCCCTTAGGAGAGCTGTTAACATTATACT1949AATGTTGTCAATGAAAAGCTAAGATAGGCCAGCATGGTGGCTCAC
XM_045379571.1|CYP2G2;102125069|chr19:38697275:38722996:-|prespliced::chr19:38697275-38722996(-)
position: 13802-13816
TTCCCTTAGGAGAGCTGTTAACATTATACT13802AATGTTGTCAATGAAAAGCTAAGATAGGCCAGCATGGTGGCTCAC
XM_015437656.2|LOC102132338;102132338|chr16:63370524:63511418:-|prespliced::chr16:63370524-63511418(-)
position: 27232-27246
GCCTCTGGGCCTATATTAGATGGGCCATGC27232TTCATTGACAACATTGATTTTATGTTTATTTGTGAAAGGGCAGAA
XM_005582940.3|LOC102132338;102132338|chr16:63387074:63511418:-|prespliced::chr16:63387074-63511418(-)
position: 27232-27246
GCCTCTGGGCCTATATTAGATGGGCCATGC27232TTCATTGACAACATTGATTTTATGTTTATTTGTGAAAGGGCAGAA
XM_015446088.2|HESX1;102125054|chr2:82723552:82752149:+|prespliced::chr2:82723552-82752149(+)
position: 25928-25942
ACTATGCTGCACTCCAAATACTATTGTGTT25928TTCATTGACAACATTCCCTATTACATATGCATATGAAAAACAGGC
XM_005556483.3|F11;102143421|chr5:182248922:182274145:+|prespliced::chr5:182248922-182274145(+)
position: 12093-12107
GCCTGAGCCACCATGCCCAGCTTGCTATTC12093TTCATTGACAACATTCACTTAAACAAACAAACATCCATAAAATTA
XM_005556484.3|F11;102143421|chr5:182248922:182274145:+|prespliced::chr5:182248922-182274145(+)
position: 12093-12107
GCCTGAGCCACCATGCCCAGCTTGCTATTC12093TTCATTGACAACATTCACTTAAACAAACAAACATCCATAAAATTA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/macFasRKS1912v2_RefSeq_prespliced_d3g2202/AATGTTGTCAATGAA
lang : en | db : macFasRKS1912v2_RefSeq_prespliced_d3g2202 | k : 0 | strand : | nogap : | query_string : AATGTTGTCAATGAA | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.080 | 0.071 | search_plus_done; http://172.18.8.78:28909/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=50
0.089 | 0.009 | search_minus_done; http://172.18.8.78:28909/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=43
0.092 | 0.004 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).