GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2022-07-06 07:39:09, GGGenome : Crab-eating macaque genome, macFasRKS1912v2 (Oct, 2021)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr2
position: 82749480-82749494
ACTATGCTGCACTCCAAATACTATTGTGTT82749480TTCATTGACAACATTCCCTATTACATATGCATATGAAAAACAGGC
chr5
position: 145071770-145071784
CAGAATATATTATCGCTTTGAACACAGATT145071770TTCATTGACAACATTTTGTGGGCATCCATTTAATATTAATATTAA
chr5
position: 161934065-161934079
TAAAACCTCTGATTTTGTGTAACACTCCTT161934065TTCATTGACAACATTAAACAGCAATTAACTATTTGCTGACTACAT
chr5
position: 177467467-177467481
TTTGGACCCCCAGATCAGTCTTCATATTCT177467467TTCATTGACAACATTCATGAAGTTCTGCAGAAATTAGATAGAATT
chr5
position: 182261015-182261029
GCCTGAGCCACCATGCCCAGCTTGCTATTC182261015TTCATTGACAACATTCACTTAAACAAACAAACATCCATAAAATTA
chr14
position: 84919887-84919901
TTGAGTTTCCAGGAACATAGATATGTCTTG84919887TTCATTGACAACATTCTAGCGTTGAGGACAGTGAATAGAGCAAAC
chr17
position: 47324578-47324592
TGTTCAAAGTTTTCCCCTCCAATGTATCTT47324578TTCATTGACAACATTCGGATTTATCACATCAATCAGTCAATAAAT
chr17
position: 64160464-64160478
GCAGTCTGGAGGTTCTCCCTGGAGGCTGTA64160464TTCATTGACAACATTGCCTGAGGTAACTCACACTGAGGTGACAAC
chr19
position: 38709181-38709195
GTGAGCCACCATGCTGGCCTATCTTAGCTT38709181TTCATTGACAACATTAGTATAATGTTAACAGCTCTCCTAAGGGAA
chr11
position: 75943955-75943969
GTAAGATAGGTTTGTTCCAGAAGTTTAAAA75943955AATGTTGTCAATGAATTTGATAAAATTTAATATTCACATTAGAAG
chr16
position: 63484173-63484187
TTCTGCCCTTTCACAAATAAACATAAAATC63484173AATGTTGTCAATGAAGCATGGCCCATCTAATATAGGCCCAGAGGC
chr19
position: 38499189-38499203
ACTCCCTTAGGAGAGCTGTAACATTATACT38499189AATGTTGTCAATGAAAAGCTAAGACAGGCCAGGGGTGGTGGCTCA
chr19
position: 38550077-38550091
CTCCCTTAGGAGAGCCGTTAACATTATACT38550077AATGTTGTCAATGAAAAAGCTAAGATAGGCAGGGCGTGGTGGCTC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/macFasRKS1912v2_d3g2202/TTCATTGACAACATT
lang : en | db : macFasRKS1912v2_d3g2202 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.087 | 0.079 | search_plus_done; http://172.18.8.78:28911/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.101 | 0.015 | search_minus_done; http://172.18.8.78:28911/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=41
0.104 | 0.003 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).