GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-04-15 19:12:57, GGGenome : Malus domestica genome, v1.0p (Aug, 2012)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr12:17566725-17566739
ACCTACACATTGGAGAAATTGGCACAGTTG17566725TTCATTGACAACATTGTTAAACTTCATGGTGTACCGGTCACTATT
chr7:4234708-4234722
TTGTTAGGACTATAGATTTGGATTGAACTC4234708AATGTTGTCAATGAATATAAATAGGAGTAATTAGGTTTTCATCCT
chr16:21120906-21120920
GATACCATCTAATTATGCTGCTTCACAAAC21120906AATGTTGTCAATGAACTTATGCTGGATTCGAGTGAAATAAACTAA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/malus_x_domestica_v1.0p/TTCATTGACAACATT
lang : en | db : malus_x_domestica_v1.0p | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.076 | 0.069 | search_plus_done; http://172.18.8.72:28271/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.080 | 0.004 | search_minus_done; http://172.18.8.72:28271/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=49
0.081 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).