GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-04-15 19:41:28, GGGenome : Turkey genome, TGC Turkey_2.01/melGal1 (Dec, 2009)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr4:18742637-18742651
TTGGCACTGCTTGCTAAAAGCAGAAGTGAT18742637TTCATTGACAACATTATTTTGAAAGTGACATTCTGCCTGGAGAAT
chr4:65773504-65773518
GTTACATTCGTATTAATACTACTGTCTGAA65773504TTCATTGACAACATTATAAAACAGTACCTTTGAGACAGAAAAGAA
chr9:14224261-14224275
TAGCTGCTCATTAGAGACTGATACACCTTA14224261TTCATTGACAACATTTGTTGCTGAGTGTTTTAATGTTGTTCAACA
chrZ:52521334-52521348
CATGATAACAATCTGTGTCATGTAATTGAG52521334TTCATTGACAACATTTAAGTAATCCATAGCTCGTTTCCATTGTTC
chr1:92508803-92508817
AGTTTGAAACGGTAGGGTGAGGAGGAGAAT92508803AATGTTGTCAATGAAATTTTTAATTTGAAAAGAGTACTAAGAATG
chr2:97820742-97820756
TAGCAGACTTGTAACCTTTATGAATCTACA97820742AATGTTGTCAATGAAATGGCTTCTAAGGATGATTAAACACCATGT
chr6:4206872-4206886
TTCTAATTACATTTATGGACATCTTATTGG4206872AATGTTGTCAATGAACTCTGAATGCTGCTGACAGTGATGTTAGAC
chr7:18748445-18748459
AAAGTCAGCACTAGCTCTGACACATTAAGA18748445AATGTTGTCAATGAAAACCTAAGTAATGAATGGCATCTTCCTTGT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/melGal1/TTCATTGACAACATT
lang : en | db : melGal1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.078 | 0.071 | search_plus_done; http://172.18.8.76:28084/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.082 | 0.004 | search_minus_done; http://172.18.8.76:28084/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=46
0.083 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).