GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-04 10:49:28, GGGenome : Turkey genome, TGC Turkey_5.0/melGal5 (Nov, 2014)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr4:28814883-28814897
TTGGCACTGCTTGCTAAAAGCAGAAGTGAT28814883TTCATTGACAACATTATTTTGAAAGTGACATTCTGCCTGGAGAAT
chr4:61503832-61503846
GTTACATTCGTATTAATACTACTGTCTGAA61503832TTCATTGACAACATTATAAAACAGTACCTTTGAGACAGAAAAGAA
chr9:14207471-14207485
TAGCTGCTCATTAGAGACTGATACACCTTA14207471TTCATTGACAACATTTGTTGCTGAGTGTTTTAATGTTGTTCAACA
chrZ:44410669-44410683
CATGATAACAATCTGTGTCATGTAATTGAG44410669TTCATTGACAACATTTAAGTAATCCATAGCTCGTTTCCATTGTTC
chr1:87653676-87653690
AGTTTGAAACGGTAGGGTGAGGAGGAGAAT87653676AATGTTGTCAATGAAATTTTTAATTTGAAAAGAGTACTAAGAATG
chr2:91544557-91544571
TAGCAGACTTGTAACCTTTATGAATCTACA91544557AATGTTGTCAATGAAATGGCTTCTAAGGATGATTAAACACCATGT
chr6:4253178-4253192
TTCTAATTACATTTATGGACATCTTATTGG4253178AATGTTGTCAATGAACTCTGAATGCTGCTGACAGTGATGTTAGAC
chr7:22193376-22193390
AAAGTCAGCACTAGCTCTGACACATTAAGA22193376AATGTTGTCAATGAAAACCTAAGTAATGAATGGCATCTTCCTTGT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/melGal5/TTCATTGACAACATT
lang : en | db : melGal5 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.080 | 0.073 | search_plus_done; http://172.18.8.76:28775/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.084 | 0.004 | search_minus_done; http://172.18.8.76:28775/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=46
0.085 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).