GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-08-14 23:19:31, GGGenome : Mouse lemur genome, Broad/micMur1 (Jul, 2007)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

scaffold_261:611333-611347
AGCACATTTACAAAGTAAGAAATTTCCCAA611333TTCATTGACAACATTAACAGAGTCCAGTATAACCTGAAACATATA
scaffold_1590:35053-35067
TAACATGTTTAAAAGAACGATTAATTGGCC35053TTCATTGACAACATTTAAAATTAATTATTTTTACCCAATTAAGGA
scaffold_1790:76869-76883
ACTAAATAAATGTTGCATTAAAGAACAAGT76869TTCATTGACAACATTGCAGTAAAATTGCTTTGCTTCTGACATTTC
scaffold_1913:169238-169252
CAATCAAAGGTCAGAGATTAAGGAAATTAT169238TTCATTGACAACATTAAATATTTACTGAATCTCAACTTTATCCTG
scaffold_2638:185233-185247
ATAGATCACAAAATTACAAAATTGTATGTT185233TTCATTGACAACATTTGAAAAATAAGGGGGTAGAAAAACCTGTTG
scaffold_4666:85381-85395
AAATCTAAAATGTATGATTTATTAAGTTAC85381TTCATTGACAACATTTTACATTTTTCACACCTTTAGTTTGTTCTG
scaffold_11113:15997-16011
AACAGTAAATAAATAAAGGGTAGAATTGCA15997TTCATTGACAACATTCTCTTTGGCTGTGTTTTATATATTTCACCA
scaffold_15007:5014-5028
AGAATTTACTTTTTTCTTTATTTTCTTTCT5014TTCATTGACAACATTTACAAATTAGGAAATTGACCATAAAGTCTA
scaffold_27886:5848-5862
CATTTATCTCTAAAAAAGCCTACTATTTCT5848TTCATTGACAACATTCCTAGTAAGCTCCATATTGTAGACCCTTAG
scaffold_182530:477-491
CCAATAGGCTTTCGCCCAACAGCTTTAGCT477TTCATTGACAACATTTGATTAAATGAATTACAACACTGGGGTTTG
scaffold_141:704140-704154
GGCCAAGCACAGGCATCTTGCAGTCTGTAA704140AATGTTGTCAATGAAAGTCACAGCTGGAAAGCAGTGTGCCCAGAC
scaffold_681:39190-39204
ATACCTGTCTGCTGACAAAAATAATTTCAG39190AATGTTGTCAATGAATGAACTGCATGTCTCTACTATATATGGAAT
scaffold_962:372928-372942
TCACAATAGCCAAGCTGTGAAAACAACCTA372928AATGTTGTCAATGAATAAATAGATAAAGAAAATATGATATAGATA
scaffold_1650:166948-166962
TTAATTTTAAAGTTACAAAAATCATTTCTA166948AATGTTGTCAATGAATATAAAATGACCCTTTAAGAATCATAAAAA
scaffold_5445:13680-13694
GAACAGTGGAAAAGAGCTATGGATTATTTA13680AATGTTGTCAATGAACTCAACTACATGACTCAGATTGTTATCATG
scaffold_11244:4742-4756
AGGGAAACTTTTCATCCATTTCATCAAAAC4742AATGTTGTCAATGAAAGAGGAGGTTTTGTTTAACCAAATATTTTG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/micMur1/TTCATTGACAACATT
lang : en | db : micMur1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.079 | 0.072 | search_plus_done; http://172.18.8.77:28045/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.085 | 0.006 | search_minus_done; http://172.18.8.77:28045/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=40
0.086 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).