GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-04 11:42:37, GGGenome : Mouse genome, GRCm38/mm10 (Dec, 2011)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr2:131480113-131480127
AGACAAATTAAGACTGTATTGTATCATGGT131480113TTCATTGACAACATTTAAAATTGTTACATATTTCAAAATTTTTTA
chr5:42318229-42318243
TAGAATCAGTGTAAGCCATCCCTACACTTA42318229TTCATTGACAACATTCATGCAATCTTCAGTGTTCATTACTTTGCT
chr6:141421528-141421542
AAAGTACTATCAGTTTCCTAAATATATCCA141421528TTCATTGACAACATTGTTCACTCTTCCATAAACATCTGCTGGTTA
chr6:146175076-146175090
TGAACACATTCTCCCTGTTTGTGTCATCAC146175076TTCATTGACAACATTTAACTGGGCCTTCTGTGTGGATACCATGAT
chr10:47062898-47062912
TATTTCTTTCTGTTTGTTTATATGATGGAC47062898TTCATTGACAACATTTCATATATGTAACCATCCTGTATCTCTGTA
chr14:109241664-109241678
TGCTGCTGGAATCTCTCCCTGGAGGGTGTG109241664TTCATTGACAACATTGCCCACTGAGAGTGACAACCTCAGCAGCCA
chr1:32385455-32385469
TTTTTAAAGACAGCAGGAAATAGCAAATAA32385455AATGTTGTCAATGAACAGTGTTTCCAAATGGTACATTAAGTATTC
chr2:47333047-47333061
ATATCTATTTATTCATTGATGTAGCTTTCA47333047AATGTTGTCAATGAACACTGTTACTTCGTTGAGCACATGAAAAGT
chr3:39320050-39320064
GTTGCCCCAGATTCAAGCTGCATGTTGACC39320050AATGTTGTCAATGAACTTCAACTACAAGTTCTGAGGCAGAATCTA
chr3:42777516-42777530
TTAAACATCAGAGAAATGAAAAATAAGTAA42777516AATGTTGTCAATGAATAAACATCCCTGTAAGTTAAGGTTTGCAAT
chr5:8380809-8380823
TAGCATCCATGCCCCCAAGCCAAAAGCATC8380809AATGTTGTCAATGAAACATTACTAAAGTTTAAAGTACATGTTGAC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/mm10/TTCATTGACAACATT
lang : en | db : mm10 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.076 | 0.069 | search_plus_done; http://172.18.8.78:28019/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.080 | 0.004 | search_minus_done; http://172.18.8.78:28019/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=44
0.081 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).