GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-12-05 14:14:13, GGGenome : Mouse pre-spliced RNA, RefSeq curated protein coding on mm10, D3G 21.01 (Jan, 2021)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

NM_010586.2|Itpr2;16439|chr6:146108298:146502223:-|prespliced::chr6:146108298-146502223(-)
position: 327134-327148
ATCATGGTATCCACACAGAAGGCCCAGTTA327134AATGTTGTCAATGAAGTGATGACACAAACAGGGAGAATGTGTTCA
NM_019923.4|Itpr2;16439|chr6:146108298:146502223:-|prespliced::chr6:146108298-146502223(-)
position: 327134-327148
ATCATGGTATCCACACAGAAGGCCCAGTTA327134AATGTTGTCAATGAAGTGATGACACAAACAGGGAGAATGTGTTCA
NM_133235.2|Khdrbs2;170771|chr1:32172805:32657738:+|prespliced::chr1:32172805-32657738(+)
position: 212650-212664
TTTTTAAAGACAGCAGGAAATAGCAAATAA212650AATGTTGTCAATGAACAGTGTTTCCAAATGGTACATTAAGTATTC
NM_018779.1|Pde3a;54611|chr6:141249268:141499351:+|prespliced::chr6:141249268-141499351(+)
position: 172260-172274
AAAGTACTATCAGTTTCCTAAATATATCCA172260TTCATTGACAACATTGTTCACTCTTCCATAAACATCTGCTGGTTA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/mm10_RefSeqCuratedProtCoding_prespliced_d3g2101/AATGTTGTCAATGAA
lang : en | db : mm10_RefSeqCuratedProtCoding_prespliced_d3g2101 | k : 0 | strand : | nogap : | query_string : AATGTTGTCAATGAA | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.076 | 0.068 | search_plus_done; http://172.18.8.75:28866/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=50
0.081 | 0.005 | search_minus_done; http://172.18.8.75:28866/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=47
0.082 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).