GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2024-02-28 07:32:49, GGGenome : Mouse pre-spliced RNA, RefSeq curated on GRCm39/mm39, D3G 23.02 (Feb, 2023)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

NM_018779.2|Pde3a;54611|chr6:141194994:141451666:+|prespliced::chr6:141194994-141451666(+)
position: 172260-172274
AAAGTACTATCAGTTTCCTAAATATATCCA172260TTCATTGACAACATTGTTCACTCTTCCATAAACATCTGCTGGTTA
NM_010586.2|Itpr2;16439|chr6:146009796:146403721:-|prespliced::chr6:146009796-146403721(-)
position: 327134-327148
ATCATGGTATCCACACAGAAGGCCCAGTTA327134AATGTTGTCAATGAAGTGATGACACAAACAGGGAGAATGTGTTCA
NM_019923.4|Itpr2;16439|chr6:146009796:146403721:-|prespliced::chr6:146009796-146403721(-)
position: 327134-327148
ATCATGGTATCCACACAGAAGGCCCAGTTA327134AATGTTGTCAATGAAGTGATGACACAAACAGGGAGAATGTGTTCA
NM_133235.3|Khdrbs2;170771|chr1:32211802:32697650:+|prespliced::chr1:32211802-32697650(+)
position: 212734-212748
TTTTTAAAGACAGCAGGAAATAGCAAATAA212734AATGTTGTCAATGAACAGTGTTTCCAAATGGTACATTAAGTATTC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/mm39_RefSeqCurated_prespliced_d3g2302/TTCATTGACAACATT
lang : en | db : mm39_RefSeqCurated_prespliced_d3g2302 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.009 | 0.009 | search_start;
0.096 | 0.088 | search_plus_done; http://172.18.8.78:28941/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.103 | 0.007 | search_minus_done; http://172.18.8.78:28941/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=49
0.105 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).