GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2024-06-17 06:09:34, GGGenome : Mouse genome, GRCm39/mm39 (Jun, 2020)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr2
position: 131322033-131322047
AGACAAATTAAGACTGTATTGTATCATGGT131322033TTCATTGACAACATTTAAAATTGTTACATATTTCAAAATTTTTTA
chr5
position: 42475572-42475586
TAGAATCAGTGTAAGCCATCCCTACACTTA42475572TTCATTGACAACATTCATGCAATCTTCAGTGTTCATTACTTTGCT
chr6
position: 141367254-141367268
AAAGTACTATCAGTTTCCTAAATATATCCA141367254TTCATTGACAACATTGTTCACTCTTCCATAAACATCTGCTGGTTA
chr6
position: 146076574-146076588
TGAACACATTCTCCCTGTTTGTGTCATCAC146076574TTCATTGACAACATTTAACTGGGCCTTCTGTGTGGATACCATGAT
chr10
position: 46938994-46939008
TATTTCTTTCTGTTTGTTTATATGATGGAC46938994TTCATTGACAACATTTCATATATGTAACCATCCTGTATCTCTGTA
chr14
position: 109479096-109479110
TGCTGCTGGAATCTCTCCCTGGAGGGTGTG109479096TTCATTGACAACATTGCCCACTGAGAGTGACAACCTCAGCAGCCA
chr1
position: 32424536-32424550
TTTTTAAAGACAGCAGGAAATAGCAAATAA32424536AATGTTGTCAATGAACAGTGTTTCCAAATGGTACATTAAGTATTC
chr2
position: 47223059-47223073
ATATCTATTTATTCATTGATGTAGCTTTCA47223059AATGTTGTCAATGAACACTGTTACTTCGTTGAGCACATGAAAAGT
chr3
position: 39374199-39374213
GTTGCCCCAGATTCAAGCTGCATGTTGACC39374199AATGTTGTCAATGAACTTCAACTACAAGTTCTGAGGCAGAATCTA
chr3
position: 42731951-42731965
TTAAACATCAGAGAAATGAAAAATAAGTAA42731951AATGTTGTCAATGAATAAACATCCCTGTAAGTTAAGGTTTGCAAT
chr5
position: 8430809-8430823
TAGCATCCATGCCCCCAAGCCAAAAGCATC8430809AATGTTGTCAATGAAACATTACTAAAGTTTAAAGTACATGTTGAC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/mm39_d3g2202/TTCATTGACAACATT
lang : en | db : mm39_d3g2202 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.009 | 0.009 | search_start;
0.081 | 0.072 | search_plus_done; http://172.18.8.78:28916/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.088 | 0.007 | search_minus_done; http://172.18.8.78:28916/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=44
0.091 | 0.003 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).