GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-01 11:53:34, GGGenome : Mouse genome, NCBI37/mm9 (Jul, 2007)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr2:131305849-131305863
AGACAAATTAAGACTGTATTGTATCATGGT131305849TTCATTGACAACATTTAAAATTGTTACATATTTCAAAATTTTTTA
chr5:42709468-42709482
TAGAATCAGTGTAAGCCATCCCTACACTTA42709468TTCATTGACAACATTCATGCAATCTTCAGTGTTCATTACTTTGCT
chr6:141370049-141370063
AAAGTACTATCAGTTTCCTAAATATATCCA141370049TTCATTGACAACATTGTTCACTCTTCCATAAACATCTGCTGGTTA
chr6:146123598-146123612
TGAACACATTCTCCCTGTTTGTGTCATCAC146123598TTCATTGACAACATTTAACTGGGCCTTCTGTGTGGATACCATGAT
chr10:46782704-46782718
TATTTCTTTCTGTTTGTTTATATGATGGAC46782704TTCATTGACAACATTTCATATATGTAACCATCCTGTATCTCTGTA
chr14:109640881-109640895
TGCTGCTGGAATCTCTCCCTGGAGGGTGTG109640881TTCATTGACAACATTGCCCACTGAGAGTGACAACCTCAGCAGCCA
chr1:32442300-32442314
TTTTTAAAGACAGCAGGAAATAGCAAATAA32442300AATGTTGTCAATGAACAGTGTTTCCAAATGGTACATTAAGTATTC
chr2:47188567-47188581
ATATCTATTTATTCATTGATGTAGCTTTCA47188567AATGTTGTCAATGAACACTGTTACTTCGTTGAGCACATGAAAAGT
chr3:39218972-39218986
GTTGCCCCAGATTCAAGCTGCATGTTGACC39218972AATGTTGTCAATGAACTTCAACTACAAGTTCTGAGGCAGAATCTA
chr3:42581438-42581452
TTAAACATCAGAGAAATGAAAAATAAGTAA42581438AATGTTGTCAATGAATAAACATCCCTGTAAGTTAAGGTTTGCAAT
chr5:8380809-8380823
TAGCATCCATGCCCCCAAGCCAAAAGCATC8380809AATGTTGTCAATGAAACATTACTAAAGTTTAAAGTACATGTTGAC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/mm9/TTCATTGACAACATT
lang : en | db : mm9 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.081 | 0.074 | search_plus_done; http://172.18.8.78:28020/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.086 | 0.005 | search_minus_done; http://172.18.8.78:28020/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=44
0.087 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).