GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2022-01-18 16:28:51, GGGenome : Opossum genome, Broad/monDom5 (Oct, 2006)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr1:169926582-169926596
TTTTGCTAAAATATAGTCAAAACAAAAGAA169926582TTCATTGACAACATTCCCTCACTAGAATTACAGTAATAGGTGCGC
chr1:679211418-679211432
CTTACAAAACTTTTTCAGCTAAGTTAAATA679211418TTCATTGACAACATTTTTCTACATTTTTATTCTCTACCAGTGATA
chr2:65195163-65195177
CAAGAAAGTTCCAGAAAAATCCATTTCTGT65195163TTCATTGACAACATTATAGCCTTTGATTATTTACTCTACAACAAA
chr2:424769096-424769110
CAAACACACATAAAATGTTTAGCTGTGAAC424769096TTCATTGACAACATTCTGGGTTGGTGTGCATGCAGGCAGGCTATA
chr3:55169335-55169349
CATTTCAGACATTTAAAAATGTTTTGATCA55169335TTCATTGACAACATTCCTCTTCTACTTATCCTAATTTTTAGTAAT
chr3:73547852-73547866
TGCCTTTGGGTTTTGATGTTGTTGCTTCAC73547852TTCATTGACAACATTTTCAATGGCTACTCCTGAAACAAGTAGAAA
chr3:144471958-144471972
TTACACTGACAACTACAATATATGTGACAT144471958TTCATTGACAACATTTCTGGTAAAGATATTACAGATCTTTCTACC
chr3:191446710-191446724
GATGCTATTTTGTGTGTCAGTTTGAGCTGG191446710TTCATTGACAACATTTTGTACAGTTGCTGGAGTTGTCTCATTTTC
chr4:33492520-33492534
CCCCTCTAAGGAGGAGGTAATTACCAGTAG33492520TTCATTGACAACATTTTAGAAATGTATTCCCAATGAGGGCTACCT
chr4:125289723-125289737
TAATGTCTACTCCAATCATCCTTGACTCTA125289723TTCATTGACAACATTCCCATTCCCAAGATAGTCCATAGAAAAAAA
chr4:129300285-129300299
GGCACTCTGTCTTTTACCAAGGGACCATTC129300285TTCATTGACAACATTATTTTGTATTGTATTTATTGAAGGCTGTTA
chr5:71135119-71135133
ACTTCCTAAATATTCTCTTCTCTCTAGGAT71135119TTCATTGACAACATTCTCTTGTAGTTTAAGAAAAAATCTGACTTC
chr6:167591599-167591613
TTCTCTCTCATAAGTCACTCCAGCCATCGG167591599TTCATTGACAACATTTATTAGGCACCTACTGTGTGTCAGGCACCG
chr7:30934936-30934950
ACTCAAAGTCAACCTCATACCTGACTGCAA30934936TTCATTGACAACATTTTTAAACAACAGTCTGTTGACTTCTGAGGA
chr7:131117027-131117041
AGATTACAAGTTGTAGAATATTTGCTGATT131117027TTCATTGACAACATTGAAATCACAGGTTAATACCTTACTTACACA
chr8:49825449-49825463
CAATCAGGGGTTCAGAACTTCAAATGGTAA49825449TTCATTGACAACATTGGCAAAATGACAAACAGAACAATTACCAAT
chr8:193890872-193890886
AGTTTTTCTGTGTTCACCTGCTTTTCATGT193890872TTCATTGACAACATTGTAGGCATTGTGGATATCATTCTCTTTGTT
chr1:265105457-265105471
AGGAAAATCAAATTGGATAATGATTTTCTC265105457AATGTTGTCAATGAATCAGACTAATCATAATGAAGATCCTCACTC
chr1:491866000-491866014
TTGGGGAACTGATGTCATCTTTCATTTTGA491866000AATGTTGTCAATGAAAATTGGCATGGGATGCCTTTGGAGATGCTG
chr2:270495646-270495660
AGGGAAGGAGCAGACAGAGGAGAGATACAG270495646AATGTTGTCAATGAAATTTTAGTGGGAAAGAACACTTTCTCTGGA
chr3:401816834-401816848
GGTTAAAATAGATTATGAGCTATTTAAGGG401816834AATGTTGTCAATGAACTGTTGGCATATAGGGAACAATCAGGAACC
chr5:11662563-11662577
ATCCCAGTCTCTAGAAGTCCAGGAGTCTCT11662563AATGTTGTCAATGAAGCAATAGAGGGTATCATTAGCACTCTACTG
chr5:143213850-143213864
TTTACATTTCTTTCTACCATTAAAATAAGG143213850AATGTTGTCAATGAACTTTCTCTGAACTGAATGACCTTTTATAGA
chr5:160890505-160890519
TCTTAGAAATTTACAGGAAAGGGAAAAGGA160890505AATGTTGTCAATGAATGTGGACAAACATTAGAGAGAGAACATTTG
chr7:116286449-116286463
ATATCCATTCCTTTTATATTTATTCCACAA116286449AATGTTGTCAATGAAGAATACAATTAATATCTTATCTCTCAAAAA
chr7:173732290-173732304
ATGGGTACAGGGAGGTTCGAAGTGAGGACA173732290AATGTTGTCAATGAAGAATGAGAGCTACAATTAGGAGAGGTAGGA
chr7:206644625-206644639
ATTTCAGAGACACTGAAACAGCTCATTGAT206644625AATGTTGTCAATGAATGAATTTCATAGGGATAAATGTAAAATAAA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/monDom5/TTCATTGACAACATT
lang : en | db : monDom5 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.081 | 0.074 | search_plus_done; http://172.18.8.77:28047/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.089 | 0.008 | search_minus_done; http://172.18.8.77:28047/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=33
0.091 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).