GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-12-01 11:50:16, GGGenome : Ferret genome, MusPutFur1.0/musFur1 (Apr, 2011)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

GL896908:5547337-5547351
AATCACCTATCTTATTTCAGCATTCTCCTT5547337TTCATTGACAACATTAAAAAGTATCATTTAAAAAATTCTTATTTA
GL896915:4455544-4455558
AAGCAAACTTCTCATATGTATAAATAGATA4455544TTCATTGACAACATTTGTTTTCCTGAAGATTTTATTTATTTATTA
GL896920:4196790-4196804
TCCTACTACATCACTGAAATATGGTTGCAT4196790TTCATTGACAACATTGCCAAGAATATGATTAAAATTTTCCATATG
GL896943:7467724-7467738
GGAAAGCAGGGACGAATTCAAAGGTCATTG7467724TTCATTGACAACATTCAGAATGTTGTCACCATGAAAAAGACACCG
GL896960:4523036-4523050
TAGAATATATTATCACTTTAAACACAGATT4523036TTCATTGACAACATTCTGTGGGCATCCATTTAATATTAATATTAA
GL897005:4438287-4438301
ATCTCAAATTCAGCTGATTAGCAGTATAAT4438287TTCATTGACAACATTAATTCTTCTTTTGCCATATAACAACACATT
GL897050:874852-874866
AGTTTTGGGTACAAAGATGTTTGCGGTAGC874852TTCATTGACAACATTAAAAATGCACACTGTTCCAACAAAGATAGG
GL897104:2748839-2748853
AAACCATGGTGTTTTAGAGAATATTTTGAC2748839TTCATTGACAACATTGAAAAATGCACAGTTTCAGAAGGGAAAAAG
GL897156:890730-890744
GCTTAACTAACTAGGCCACCCAGGCACCCC890730TTCATTGACAACATTTATAAAAGTTCTCCAAAACTTGCTATGACA
GL896898:33256943-33256957
GTGTTCAACATTTGTAATAATGTTGGGAAT33256943AATGTTGTCAATGAAAGAAGTTTGTCTCTTTCTGTTTATTCAGAT
GL896899:6910408-6910422
GCCCGTTTTTCATATGCATATGTAATAGTG6910408AATGTTGTCAATGAAAACACAATAGTATTTGGAGTGCAGCATACT
GL896901:1081565-1081579
CAAAATGGGTGTCCTTGTGGAAACCCAACA1081565AATGTTGTCAATGAAGTATGAGGATAACATGCTAGAAAAGTACCC
GL896912:14201319-14201333
CTTTCACAGTCCATGATGCAAACTCATCAC14201319AATGTTGTCAATGAATACACGCCCTGGGTTAGAAAGCCTATATTT
GL896938:7658382-7658396
AAATGATATTATTGTTGAAAGTGCTTCGCC7658382AATGTTGTCAATGAACACACAAGGACCTTTCAAACAGCAAAATGT
GL896985:804387-804401
CCCTTTTCTGGCAACAAAAGTTTAGATAGA804387AATGTTGTCAATGAAGAGGCTTTAAAAATGATGACAGGTTAGCTA
GL897044:4321449-4321463
GAACAGTGGAAACGAGCTATGGATTACTTA4321449AATGTTGTCAATGAACTCAATTATATGACTCAGATTGTGATCATG
GL897059:3339980-3339994
ACCAAATCTTGTCTTCTTGTCTTATGGCCA3339980AATGTTGTCAATGAAAACTAAAGAGATTCAGAATTTTAAACTTTT
GL897101:370504-370518
AGGGTTAAATACAGCTTTTAATTTGCATAT370504AATGTTGTCAATGAAAAGTTCCCCCAACATCCAAGCATCTGTTGT
GL897111:1843306-1843320
TTTTGTAATTAGAGATAGTTTATATGATAG1843306AATGTTGTCAATGAATTATTCTCATTTCACTGTACTCTATATAGA
GL897113:3033999-3034013
GTATTTGAATACAGTAAATGAACCTGGTAA3033999AATGTTGTCAATGAAATAGATCCTCTTTATGTTTTCATATGTATT
GL897298:413755-413769
ATGATGCTTATCAGGAATCTGGGAACAAAG413755AATGTTGTCAATGAAGCTTCCAAGAAGGAGAAATTTTGGAGGAAA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/musFur1/TTCATTGACAACATT
lang : en | db : musFur1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.087 | 0.080 | search_plus_done; http://172.18.8.78:28033/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.094 | 0.006 | search_minus_done; http://172.18.8.78:28033/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=41
0.096 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).