GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2024-02-28 09:34:21, GGGenome : Proboscis monkey genome, Charlie1.0/nasLar1 (Nov, 2014)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr2:75500340-75500354
ACTATGCTGCACTCCAAATACTATTGTGTT75500340TTCATTGACAACATTCCCTATTACATATGCATATGAAAAACAGGC
chr5:135159794-135159808
CAGAATATATTATCGCTTTGAGCACAGATT135159794TTCATTGACAACATTTTGTGGGCATCCATTTAATATTAATATTAA
chr5:151231824-151231838
TAAAACCTCTGATTTTGTGTAACACTCCTT151231824TTCATTGACAACATTAAACAGCAATTAACTATTTGCTGACTACAT
chr6:43025528-43025542
TTAAGTCTTATTAACTTAAATTGCTATTAT43025528TTCATTGACAACATTAATAACTGTATAACAAACTATGCAAGCTTT
chr15:93336292-93336306
AATTAAAACAAGTGTTCAATTTTCATGTCT93336292TTCATTGACAACATTTGAGATGAAATAATACTGAAAAGTAGGACT
chr16:12402320-12402334
GCCTCTGGGCCTATGTTAGATGGGCCATGC12402320TTCATTGACAACATTGATTTTATGTTTATTTGTGAAAGGGCAGAA
chr17:60398302-60398316
GCAGTCTGGAGGTTCTCCCTGGAGGCTCTA60398302TTCATTGACAACATTGCCTGAGGTAACTCACACTGAGGTGACAAC
chr18:4267498-4267512
AGCTACAGCACTCTACAGTGGACACCCACA4267498TTCATTGACAACATTATTTCCACAGGAAAACTTACTCTAATTTCA
chr1:79671209-79671223
TGGAGTAGAGGGCGGAAACTCATGCCCAGC79671209AATGTTGTCAATGAAAGTCAACACAGTAGGGGAAAAAAATGGGGA
chr4:46769730-46769744
ACTTGCCTTGACACTGAAAAGTCTAATTGC46769730AATGTTGTCAATGAAGGCTGAATAACTAGGATCTGTGAAATGTAC
chr6:9305840-9305854
GAGGGCCTTTCCAGCTCCAAGGTCAATGGC9305840AATGTTGTCAATGAAAGATCAGCAGGTCAGTGCATTATACCCAGA
chr7:13946024-13946038
ATACCTGTCTGCTAACAAAATTAATTTCAG13946024AATGTTGTCAATGAATGAAGTGCATGTTCTCTACTGTTTATGAGA
chr18:61148046-61148060
AATATTATAGTCTCCATAAAGAACATAACC61148046AATGTTGTCAATGAATTTGTGGTTATATTTGATGACCACTGATTT
chrUn_JMHX01173011v1:382-396
AATTCTGTTTAATTTCTGCAGAACTTCATG382AATGTTGTCAATGAAAGAATATGAAGACTGATTTGGGGGTCCAAA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/nasLar1/TTCATTGACAACATT
lang : en | db : nasLar1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.009 | 0.009 | search_start;
0.097 | 0.089 | search_plus_done; http://172.18.8.78:28770/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.105 | 0.008 | search_minus_done; http://172.18.8.78:28770/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=42
0.107 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).