GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-04 11:44:44, GGGenome : Pika genome, OchPri3.0/ochPri3 (May, 2012)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

JH802061:3272512-3272526
AGTGTGTTAGAAAATGGAGCATAAGTCCTC3272512TTCATTGACAACATTTGCTTTGTATTTATTGTTCTTTCATCCCTG
JH802067:40758941-40758955
TAACTTGTTTACTTTTAAAAAGACACTTAT40758941TTCATTGACAACATTAAATGGTTTCACAATTTTTAACCCATGATT
JH802081:13397716-13397730
ATAATATTTTCTTTTATTTCAACTCAGTAT13397716TTCATTGACAACATTTCCTTTTTTGGAAAGCACTGTGGAATTCAA
JH802084:18547005-18547019
CACAAAAGTCCATTTAAGCACTAACTGCAC18547005TTCATTGACAACATTCAACTAGACATTATTTTTACAAACCGATGT
JH802086:24593974-24593988
TCTCACGCCACTTCCACAAAGGAATTCAGC24593974TTCATTGACAACATTTTGCGGGACTATTTGTACGGATTCTTTTCA
JH802100:5488774-5488788
GTTTTTCTTCTGACAGTTTTATTATTCTTT5488774TTCATTGACAACATTTTTTTTCACCCACCCACCTTCAAAACTCAC
JH802062:2540566-2540580
ACAAAATTATACCGTGGGTTTGTGTAATTA2540566AATGTTGTCAATGAATGCACTTTGGGCTCATCTTCTCAGGCTGGC
JH802062:73924553-73924567
AGTCATCATGCCAGGCCCCTGATTTGTATT73924553AATGTTGTCAATGAATCGCCACAATGATTTATTTTCAGTATAATT
JH802086:2853227-2853241
CTGGCTGGCTGGCTGAATGGAGATGACTTG2853227AATGTTGTCAATGAAGGCCTCTGGTAATGGGAGCTTGATCTTATC
JH802101:9225024-9225038
ATTCTGTGACTGTGGCTCTTCTTTTGCTTG9225024AATGTTGTCAATGAAATGTTTGGAATCTTTCTAAAGTTGCCTCAT
JH802142:6224454-6224468
GAAGGTGCAGAAAGAGAAGCTAGGTTTAAA6224454AATGTTGTCAATGAAATAATAAACGAAAACTTCCCTAATCTGGAG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/ochPri3/TTCATTGACAACATT
lang : en | db : ochPri3 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.078 | 0.072 | search_plus_done; http://172.18.8.77:28051/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.083 | 0.005 | search_minus_done; http://172.18.8.77:28051/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=44
0.084 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).