GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-12-01 13:09:31, GGGenome : Platypus genome, ASM227v2/ornAna2 (Feb, 2007)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chrUn_DS188537v1:6692-6706
CCCAAAGAGCTGACTATTTGTAGATACAAT6692TTCATTGACAACATTTTGATCTTTGAACAGAAAAGAACTCCAAAA
chrUn_DS203120v1:2460-2474
CATTGGGTAGATACAATCAAGGAAACAGAA2460TTCATTGACAACATTCAACTCTGTGTCCTAATTGGTGTTCCTTTT
chrUn_DS181181v1:296194-296208
GCAACTAAATAGAATCGAGGCGATGTACAA296194TTCATTGACAACATTGATAGGGTGAAGAAAATATAAACAAGTGGG
chrUn_DS181354v1:1487358-1487372
TCCTTTCCAGGCATCTGATTTTGTGTATGG1487358TTCATTGACAACATTGGAGGAACTTCAAGAAATTGGATTTGTCTT
chrUn_DS181354v1:1489156-1489170
TCCTTTCCAGGCATCTGATTTTGTGTATGG1489156TTCATTGACAACATTGGAGGAACTTCAAGAAATTGGATTTGTCTT
chrUn_DS180881v1:1285044-1285058
TTTTAAAACTATTTTATGAGGCTATTCATT1285044TTCATTGACAACATTTTAAGTACAAATATGACACAGCCCTATAGG
chr7:10300979-10300993
TAGACTCAAACACAATAAAATCATACTTAT10300979AATGTTGTCAATGAAATTTAAGACACCATTGCAAGTTTCTGCATT
chr12:15581192-15581206
CTGAGGAAGTGATCCAGTTATGAACCCATG15581192AATGTTGTCAATGAATCATGGACTAAAGCAGAGAGACCTAGAATC
chrUn_DS181637v1:3296920-3296934
GTACAAGGTGAAAAATTTTCTTGCCAGAAC3296920AATGTTGTCAATGAAACCACAGCTGGCCAGCTTCACCCGAATGAT
chrUn_DS205068v1:4376-4390
CTTTTATTCCAAACTTATTTTTGTAAGGGG4376AATGTTGTCAATGAATCATGGCACACATGGTTTGTATATTTGTGG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/ornAna2/TTCATTGACAACATT
lang : en | db : ornAna2 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.094 | 0.087 | search_plus_done; http://172.18.8.77:28769/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.104 | 0.010 | search_minus_done; http://172.18.8.77:28769/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=44
0.105 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).