GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2024-04-13 22:22:55, GGGenome : Medaka genome, NIG/UT MEDAKA1/oryLat2 (Oct, 2005)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr2:28980457-28980471
TTTCTTTTGTGAGGGGCCTGCACCACAGAG28980457AATGTTGTCAATGAACTGGCTGAGGTTTTACACTATGTACTTTCT
chr6:24345667-24345681
AAATTAACTTCATCCGCAACAAAAAAGAAA24345667AATGTTGTCAATGAAAGCCACTTCCATTCTCGTAATACATAATTT
chr7:9428541-9428555
CATTGTGTTATGCGTCCTGATTGGCTGTAG9428541AATGTTGTCAATGAATCTCCTCCGTGCTGCATGTCCTGTACAGAC
chr20:10412061-10412075
AATTTGAATCACTTAAAAAAATGATAGCAA10412061AATGTTGTCAATGAAAAAAATTACAAACAAAAAAGATTCTGTCAA
scaffold3556:4762-4776
ACCAAGAAAACCGTCGATTGACAGCAAAGA4762AATGTTGTCAATGAATCCAAGGATGTTTCATCTTCATCAAAGGCG
chr4:5813899-5813913
AATGTGGCAGATCTGAAGGATGTTGTGGAG5813899TTCATTGACAACATTTCTTGGAGCATTAAAAACATATACCAGTAA
chr22:15483311-15483325
TGGCTCAAAACATTGACAGTTATCTGCAGA15483311TTCATTGACAACATTGGTTGTTTGAATTCAGTCTTTGTTTTTTTT
ultracontig90:1621423-1621437
TGTAACCCTAACCTGCAGGTCTTCAATGTG1621423TTCATTGACAACATTGATGAGAGGCTCCCCAGAATCGCTCTGTTC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/oryLat2/AATGTTGTCAATGAA
lang : en | db : oryLat2 | k : 0 | strand : | nogap : | query_string : AATGTTGTCAATGAA | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.080 | 0.072 | search_plus_done; http://172.18.8.76:28078/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=50
0.084 | 0.004 | search_minus_done; http://172.18.8.76:28078/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=45
0.085 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).