GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-08-13 08:35:03, GGGenome : Sheep genome, ISGC Oar_v4.0/oviAri4 (Nov, 2015)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr2:195029773-195029787
TTTGTAATACATTTATCAAATAAAGGAGAA195029773TTCATTGACAACATTTACCCAAGTGAATTACAGGGTCAAAAATTC
chr3:185076741-185076755
AGAGAATTCCAGAAAACCATCTACTTCTGC185076741TTCATTGACAACATTAAAACTTTTAGCTGTGTGGATCACAAGAAA
chr4:7464907-7464921
TAAATGATCTGCCTTTTTTAAAGTAATCAT7464907TTCATTGACAACATTTCGAACACTTTGTAGCAAAAGAAAATAAAG
chr4:74442465-74442479
ACTCCCCTAAATATAAGTCCCATTTCTCCT74442465TTCATTGACAACATTTCAAACAGTATGTGTCTTCTGTTTAAATTT
chr6:95140383-95140397
GAATAATTAGAGATCTGAGATAACCTCTAG95140383TTCATTGACAACATTACTGTGGTTATGACAGTATTATTCTTTATA
chr8:932574-932588
CCAGAGCTTCTGCTTCTGTCCTGAATTAGG932574TTCATTGACAACATTCCCTTCACCACCCTACTCTTTCTTATACTT
chr13:81100274-81100288
AGAAGTGTAATTACTGGGTCAGAGTATGGA81100274TTCATTGACAACATTTGGGCTTGTTACAAATTCAGATTATTGAGT
chr23:24017559-24017573
TAGAAGTTCTTAATGTTTGTTTTCTTGGCT24017559TTCATTGACAACATTCCTTTTTGTTGTTGTGTGATCTCATCCGCT
chr4:21362544-21362558
TTAAAGAATATCCGTTCACTGAGGAATCCT21362544AATGTTGTCAATGAAGAGTGAGTCAGATGTATGCCTGTGTCATTT
chr5:99372622-99372636
GAACAGTGGAAACGAGCTATGGATTATTTA99372622AATGTTGTCAATGAACTCAACTACATGACTCAGATTGTTATCATG
chr9:55545754-55545768
TGTTTATATCTAACAAATTGGAAAACTTCA55545754AATGTTGTCAATGAAATCTCTTAGAAACCAATGCAAATATACTTG
chr18:4247957-4247971
AATGTCTAGTTAAATGATGCTTTGGTTTTT4247957AATGTTGTCAATGAAGCATCTTAAATCTCATTACTCTGCTCACAG
chr20:11414365-11414379
CAGTGCATGGCACACAGTAGGTGTGCAGTA11414365AATGTTGTCAATGAATTGATGGAAGGATGGATGGATGAATTCTGG
chrX:76708301-76708315
CCGTCAGCAGTAAGAGTTGCTGGTCTTTTA76708301AATGTTGTCAATGAATCTGCACATCTGGTCTATATGTGAAAAGAA
chrX:87569418-87569432
GTTTACTCTTAAAACTTGAATAAAAGGATC87569418AATGTTGTCAATGAAACTGTAACCATTGATTTATTCAACCCATAT
chrX:123838441-123838455
TTTCTTGTGATCCACACAGCTAAAAGTTTT123838441AATGTTGTCAATGAAGCAGAAGTAGATGGTTTTCTGGAATTCTCT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/oviAri4/TTCATTGACAACATT
lang : en | db : oviAri4 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.078 | 0.072 | search_plus_done; http://172.18.8.77:28772/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.084 | 0.006 | search_minus_done; http://172.18.8.77:28772/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=42
0.085 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).