GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-01 11:54:40, GGGenome : Crassostrea gigas genome, oyster_v9 (Sep, 2012)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

scaffold41604 dna:supercontig supercontig:GCA_000297895.1:scaffold41604:1:120665:1
position: 118780-118794
TCTCCTTATGAATACTCCAAACATGGTTCA118780TTCATTGACAACATTGTTATTTTATTTTTAAGACTAGTCAGGTAT
scaffold42096 dna:supercontig supercontig:GCA_000297895.1:scaffold42096:1:146691:1
position: 101397-101411
ACTTACATCTGACAAAGCTTGCCATAAGTC101397TTCATTGACAACATTACCGTATTTGTTTTCCTTTAAGTATTTTTT
scaffold78 dna:supercontig supercontig:GCA_000297895.1:scaffold78:1:165283:1
position: 144833-144847
TCTTCTTATGAATACTCCAAACATGGTTCA144833TTCATTGACAACATTGTTATTTTGTTTTTAAGACTAGTCAAGTAT
scaffold42604 dna:supercontig supercontig:GCA_000297895.1:scaffold42604:1:176961:1
position: 126195-126209
TTTCTTTTGAGAATTTCTTTTTGTCAATAT126195TTCATTGACAACATTAAAATTATGAACATGACAAATTGAAACGTT
scaffold42604 dna:supercontig supercontig:GCA_000297895.1:scaffold42604:1:176961:1
position: 135208-135222
ATTTTTTTGAAAATTTCTTTTTGTCAATAT135208TTCATTGACAACATTACAATTATGAACACGACAAATTGAAACGTT
scaffold1850 dna:supercontig supercontig:GCA_000297895.1:scaffold1850:1:245870:1
position: 179627-179641
TCTTCTTATGAATACTCCAAACATGGGTCA179627TTCATTGACAACATTGTTATTTTGTTTTTAAGACTAGTCAGGTAT
scaffold1886 dna:supercontig supercontig:GCA_000297895.1:scaffold1886:1:342183:1
position: 250649-250663
TTAATTCTAAATGAATTTAATTTTAAATAT250649TTCATTGACAACATTCATCTTTAATTTTAGAAAGTATTGTCCTGA
scaffold358 dna:supercontig supercontig:GCA_000297895.1:scaffold358:1:344969:1
position: 49125-49139
ATGCCATTCACAATGGTGACAATTTTAATC49125TTCATTGACAACATTTCATGACCCATTCATTGCGCTAGTTTTGAG
scaffold1144 dna:supercontig supercontig:GCA_000297895.1:scaffold1144:1:377794:1
position: 335168-335182
TCTTCTTATGAATACTCCAAACATGGTTCA335168TTCATTGACAACATTGTTATTTTGTTTTTAAGACTAGTCAGGTAT
scaffold378 dna:supercontig supercontig:GCA_000297895.1:scaffold378:1:515418:1
position: 374514-374528
TCTTCTTATGAATACTCCAAACATGGTTCA374514TTCATTGACAACATTGTTATTTTGTTTTTTAGACTAGTCAGGTAT
scaffold364 dna:supercontig supercontig:GCA_000297895.1:scaffold364:1:782576:1
position: 135165-135179
AGATCATGAAAAGTACTGTTACAATTCAAA135165TTCATTGACAACATTTACAAACTAGTGTATCCAGTGTATCTAGTG
scaffold40740 dna:supercontig supercontig:GCA_000297895.1:scaffold40740:1:98724:1
position: 13902-13916
GGATATAAAAATGTTAGTGCTTAATATACA13902AATGTTGTCAATGAATATACATACAAGAGTGTATCACTGAATACA
scaffold806 dna:supercontig supercontig:GCA_000297895.1:scaffold806:1:114422:1
position: 65704-65718
TCAGATTTATTTCTTACAAAATAATTGATA65704AATGTTGTCAATGAAAAAATAATGTTTAGTCAGGCAAGGTTTTTG
scaffold42076 dna:supercontig supercontig:GCA_000297895.1:scaffold42076:1:145082:1
position: 78286-78300
ATACCTTACTAGTCTTAAAAACAAAATAAC78286AATGTTGTCAATGAATGATCCATGTTTGGAGTATTCATAAGATGA
scaffold43242 dna:supercontig supercontig:GCA_000297895.1:scaffold43242:1:232919:1
position: 224094-224108
ATACCTGACTAGTCTTAAAAACAAAATAAC224094AATGTTGTCAATGAATGAACCATGTTTGGAGTATTCATAAGAAGA
scaffold1445 dna:supercontig supercontig:GCA_000297895.1:scaffold1445:1:261807:1
position: 251699-251713
TCTTTCTGTCTTTTGACATACAGGTATTTT251699AATGTTGTCAATGAAATCTATCATTGTGACAAGTACATCCACTCG
scaffold122 dna:supercontig supercontig:GCA_000297895.1:scaffold122:1:305171:1
position: 66826-66840
ATACCTGACTAGTCTTAGAAACAAAATAAC66826AATGTTGTCAATGAATGAACCATGTTTGGAATATTCATAAGAAGA
scaffold43772 dna:supercontig supercontig:GCA_000297895.1:scaffold43772:1:320857:1
position: 288790-288804
ATGAAGTGAAAAAACATTACGCTTTGTAAA288790AATGTTGTCAATGAAGCTACATATATCAGCAAGGCTTCGGCCAAT
scaffold1805 dna:supercontig supercontig:GCA_000297895.1:scaffold1805:1:326567:1
position: 229975-229989
ATACCTGACTAGTCTTAAAAACAAAATAAC229975AATGTTGTCAATGAATGAACCATGTTTGGAGTATTCATAAGAAGG
scaffold290 dna:supercontig supercontig:GCA_000297895.1:scaffold290:1:560459:1
position: 45175-45189
ATACCTGACTAGTCTTAAAAACAAAATAAC45175AATGTTGTCAATGAATGAACCATGTTTGGAGTATTCATAAGAAGA
scaffold361 dna:supercontig supercontig:GCA_000297895.1:scaffold361:1:667896:1
position: 465399-465413
ATACCTGACTAGTCTTAAAAACAAAATAAC465399AATGTTGTCAATGAATGAACCATGTTTGGAGTATTCATAAGAAGA
scaffold546 dna:supercontig supercontig:GCA_000297895.1:scaffold546:1:671192:1
position: 139277-139291
ATACCTGACTAGTCTTAAAAACAAAATAAC139277AATGTTGTCAATGAATGAACCATGTTTGGAGTATTCATAAGAAGA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/oyster_v9/TTCATTGACAACATT
lang : en | db : oyster_v9 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.087 | 0.080 | search_plus_done; http://172.18.8.76:28139/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.103 | 0.017 | search_minus_done; http://172.18.8.76:28139/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=39
0.109 | 0.006 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).