GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-01 10:39:09, GGGenome : Bonobo genome, MPI-EVA panpan1.1/panPan2 (Aug, 2015)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr2B:165033553-165033567
ATTGCAGCAAAGAAGCACATTTATATTCTA165033553TTCATTGACAACATTAGCATATAATGCAAATTTACTTTGGAACTT
chr3:86788421-86788435
TTGATTTTGTATATATTAAATAGTTGAAAC86788421TTCATTGACAACATTAAATTTGTTTTCTAGGCTCTATTGGGGTAA
chr4:15857754-15857768
AATGAAAGGCGTTTGAGGAAAGCCTGATAA15857754TTCATTGACAACATTACCATCAGCCACACCTTATCATTCCTAGCA
chr4:152901398-152901412
CAGAATATATTATCGCTTTAAACACAGATT152901398TTCATTGACAACATTTTGTGGGCACCCATTTAATATTAATATTAA
chr4:170083924-170083938
AAAAACCTCTGATTTTGTGTAACACTCCTT170083924TTCATTGACAACATTAAACAGCAATTAACTATTTGCTGATTACAT
chr6:64945272-64945286
CTATTTCAATCAACCATCTTGTAATCATAC64945272TTCATTGACAACATTTTACTCATACTATAATAAGTTGCTATTTCT
chr7:3854419-3854433
GTGGTGCCTGGCCTGAGTCAGCTCAGTAGC3854419TTCATTGACAACATTGGTTCGTTTAACAAATATTGCCTGAGAAGA
chr8:28003682-28003696
ATATTTTTAAATTCATCAATATTTCCACTT28003682TTCATTGACAACATTATTAAGTTTTATTGTGCCTCTTTTTCCAAA
chr11:24398670-24398684
TTGAGTTTCCTGGAACATAGATATGTCTTG24398670TTCATTGACAACATTCTAGCATTGAGGACAGTGAATAGAGCAAAG
chr12:21824944-21824958
TAATTCTAATGTGTTGAAGTCCTTTAATCA21824944TTCATTGACAACATTATCCACCAATTCATTTGCAAAGCAGATTGG
chr13:84562605-84562619
GCAGTCTGGAGGTTCTCCCTGGAGGCTGTA84562605TTCATTGACAACATTGCCTGAGGTAACTCACACTGAGGTGACAAC
chr18:26432197-26432211
ATATTTATATATGTATATATTTCATATTAT26432197TTCATTGACAACATTTACTTGGGAGATTTGTCTCAACAAAAATTA
chr19:46578344-46578358
AAGCCACCACACCCGGCCTATCTTAGCTTT46578344TTCATTGACAACATTAGTATAATGTTAACAGCTCTCCTAAGGGAG
chr2B:201364903-201364917
AATGCCCCACATTTCATTAAGGGTGATGAC201364903AATGTTGTCAATGAAGAAGTTGCTTCTCATATAACTATACTGTCA
chr3:58344604-58344618
GCCTGTTTTTCATATGCATATGTAATAGGG58344604AATGTTGTCAATGAAAACACAATAGTATTTGGAGTGCAGCATAGT
chr4:68229968-68229982
ACTCACTGGATCCAATCAGCATAATGTCAT68229968AATGTTGTCAATGAAAAGAGTTGAACTCTGTAAAATATTTGAAGA
chr5:9925533-9925547
GAGGGCCTTTCCAGCTCCAAAGTCGATGGC9925533AATGTTGTCAATGAAAGATCAGCAGGTCAGTGCATTATACCCAGG
chr7:35116640-35116654
TCTACAGATTTTGGATTTACCAGCCCCCAC35116640AATGTTGTCAATGAATTCCTTAAAATCTCTCTCTCTCTCTCTCTC
chr7:84463141-84463155
AACTAACACCCATAAAAGGTATGACTCTTT84463141AATGTTGTCAATGAAGATTTAACATAATATTCTATAACAAATATA
chr12:79488915-79488929
ATAAGATAGGTTTGTTCCAGAAGTTTAAAA79488915AATGTTGTCAATGAATTTGATAAAGTTTAATATTCACATTAAAAG
chr19:46409598-46409612
CTCCCTTAGGAGAGCTGTTAACATTATACT46409598AATGTTGTCAATGAAAAAGCTAAGATAGGCCGGGTGTGGTGGCTT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/panPan2/TTCATTGACAACATT
lang : en | db : panPan2 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.079 | 0.073 | search_plus_done; http://172.18.8.78:28752/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.086 | 0.006 | search_minus_done; http://172.18.8.78:28752/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=37
0.087 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).