GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2022-01-18 17:10:08, GGGenome : Lamprey genome, WUGSC 7.0/petMar2 (Sep, 2010)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

GL476353:200352-200366
TAAATGGATTACATATCGAGCTCAAATGCT200352TTCATTGACAACATTATATTGTTTCTTTTGACTGACGTCCCACCG
GL476434:136612-136626
CATACCATGGTTATAACAGATGAGATAACG136612TTCATTGACAACATTGTAAAACACGTGACGCTTGCTAACTAAATG
GL478326:86175-86189
TTACAATTTAATTAAAATTAGGGCGAAAAT86175TTCATTGACAACATTCAGGGTAAACGTTGTTACAATGACGGTACG
GL476790:235763-235777
ATGCATATGAAGTTAAATTTTCTATATCTT235763AATGTTGTCAATGAAACATAGAAAAAGCATCTATTCACACAACTG
GL477282:53081-53095
CAAATCCCAGTTGGGTGAACCAACTATCTT53081AATGTTGTCAATGAAGGGAGACCGGTTTGCAGGAAGTCAACAGTG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/petMar2/TTCATTGACAACATT
lang : en | db : petMar2 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.091 | 0.083 | search_plus_done; http://172.18.8.76:28076/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.096 | 0.005 | search_minus_done; http://172.18.8.76:28076/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=47
0.097 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).