GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2024-04-13 22:33:58, GGGenome : Orangutan genome, WUGSC 2.0.2/ponAbe2 (Jul, 2007)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr1_random:29492013-29492027
ACTTTTAATTTCCTTCAAGAACTTTTTCTT29492013TTCATTGACAACATTGCTAACTGTTTGGCACAGGAGACCTAGCTT
chr2b:50142033-50142047
ATTGCAGCAAAGAAGCACATTTATATTCTA50142033TTCATTGACAACATTAGCATATAATGCAAATTTACTTTGGAACTT
chr3:89050095-89050109
ACTATGCTGCACTCCAAATACTATTGTATT89050095TTCATTGACAACATTCCCTATTACATATGCACGTGAAAAACAGGC
chr3:95322310-95322324
TGGATATCTTATATGCCTTTGGAAGTTTAT95322310TTCATTGACAACATTTTTCCAGCTCCCATTTACACCACTTAACAA
chr4:154518256-154518270
CAGAATGTATTATCGCTTTAAACACAGATT154518256TTCATTGACAACATTTTGTGGGCATCCATTTAATATTAATATTAA
chr4:172357938-172357952
AAAAATCTCTGATTTTGTGTAACACTCCTT172357938TTCATTGACAACATTAAACAGCAATTAACTATTTGCTGACTATAT
chr4:189529964-189529978
TTTGGACCCCCAAATCAGTCTTCATATTCT189529964TTCATTGACAACATTCATTAAGTTCTGCAGAAATTAAATAGAATT
chr6:26121046-26121060
TAGTTAACTAGCTCTTTGAGCCTTAGTTTT26121046TTCATTGACAACATTGAGATAACAAAATCTTTGTATCTTAAAAGA
chr8:17909753-17909767
CCCATTAGGTACAAACTTTTCATTTCTGTG17909753TTCATTGACAACATTAAAATTATTACACGTCAGTTTCAATACATA
chr8:31545916-31545930
ATATTTTTAAATTCATCCATATTTCCACTT31545916TTCATTGACAACATTATTAAGTTTTTTTGTGTCTGTTTTTTCAAA
chr9:29921940-29921954
ACCTAAATATACAATTAAAGCTCAATCTAC29921940TTCATTGACAACATTGAGAAGGGCTGAGAACCTCTATATACTCAA
chr10:131707428-131707442
TCTTCAAATATTTTACAGAGTTTGACTCTT131707428TTCATTGACAACATTAATGCCTCAAAAGAAAGAAAAAGGCCAGGC
chr13:85854972-85854986
GCAGTCTGGAGGTTCTCCCTGGAGGCTGTA85854972TTCATTGACAACATTGCCTGAGGTAACTCACACTGAGGTGACAAC
chr18:41462025-41462039
ATATTTATATATGTATGTATTTCATATTAT41462025TTCATTGACAACATTTACTTGGGAGATTTGTCTCAACAAAAATTA
chr19:42204363-42204377
GAGCCACCACGCCTGGCCTATCTTAGCTTT42204363TTCATTGACAACATTAGTATAATGTTAACAGCTCTCCTAAGGGAG
chr2b:87154750-87154764
AATGCTCCACATTTCATTAAGGGTGATGAC87154750AATGTTGTCAATGAAGAAGTTGCTTTTCATATAACTATAATGTCA
chr3:59053140-59053154
TTTTTTCCACACGAAATCTCCTGATTTCTA59053140AATGTTGTCAATGAATTCTTCCCCTCCCCGCCTTTTTAAAGTAAA
chr4:57732684-57732698
ACTCACTGGATCCAATCAGCATAATGTCAT57732684AATGTTGTCAATGAAAAGAGTTGAACTCTGTAAACTATTTGAAGA
chr4:187378501-187378515
CATTGCAGATTCTTCAAGAACAGAGTCCCC187378501AATGTTGTCAATGAAAAGAAACGTTTACCTCTGTGAGATGAATGC
chr5:10363524-10363538
GAGGGCCTTTCCAGCTCCAAAGTCGATGGC10363524AATGTTGTCAATGAAAGATCAGCAGGTCAGTGCATTATACCCAGG
chr8:125256061-125256075
AATCTAGCCTTGAAAGCCCCTTCCAGAGCC125256061AATGTTGTCAATGAAGCTTTCCCTGCTGAATGATAGCTCTCTGGG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/ponAbe2/TTCATTGACAACATT
lang : en | db : ponAbe2 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.009 | 0.009 | search_start;
0.086 | 0.078 | search_plus_done; http://172.18.8.77:28048/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.094 | 0.008 | search_minus_done; http://172.18.8.77:28048/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=35
0.096 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).