GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-09-17 01:36:52, GGGenome : Orangutan genome, Susie_PABv2/ponAbe3 (Jan, 2018)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr2B:46295897-46295911
ATTGCAGCAAAGAAGCACATTTATATTCTA46295897TTCATTGACAACATTAGCATATAATGCAAATTTACTTTGGAACTT
chr3:84593114-84593128
ACTATGCTGCACTCCAAATACTATTGTATT84593114TTCATTGACAACATTCCCTATTACATATGCATGTGAAAAACAGGC
chr3:90725632-90725646
TGGATATCTTATATGCCTTTGGAAGTTTAT90725632TTCATTGACAACATTTTTCCAGCTCCCATTTACACCACTTAACAA
chr4:147708824-147708838
CAGAATGTATTATCGCTTTAAACACAGATT147708824TTCATTGACAACATTTTGTGGGCATCCATTTAATATTAATATTAA
chr4:164818774-164818788
AAAAATCTCTGATTTTGTGTAACACTCCTT164818774TTCATTGACAACATTAAACAGCAATTAACTATTTGCTGACTATAT
chr4:180824497-180824511
TTTGGACCCCCAAATCAGTCTTCATATTCT180824497TTCATTGACAACATTCATTAAGTTCTGCAGAAATTAAATAGAATT
chr6:25117798-25117812
TAGTTAACTAGCTCTTTGAGCCTTAGTTTT25117798TTCATTGACAACATTAAGATAACAAAATCTTTGTATCTTAAAAGA
chr8:17416378-17416392
CCCATTAGGTACAAACTTTTCATTTCTGTG17416378TTCATTGACAACATTAAAATTATTACACGTCAGTTTCAATACATA
chr8:30482406-30482420
ATATTTTTAAATTCATCCATATTTCCACTT30482406TTCATTGACAACATTATTAAGTTTTTTTGTGTCTGTTTTTTCAAA
chr9:8732957-8732971
ACCTAAATATACAATTAAAGCTCAATCTAC8732957TTCATTGACAACATTGAGAAGGGCTAAGAACCTCTATATACTCAA
chr10:130578299-130578313
TCTTCAAATATTTTACAGAGTTTGACTCTT130578299TTCATTGACAACATTAATGCCTCAAAAGAAAGAAAAAGGCCAGGC
chr13:67972315-67972329
GCAGTCTGGAGGTTCTCCCTGGAGGCTGTA67972315TTCATTGACAACATTGCCTGAGGTAACTCACACTGAGGTGACAAC
chr18:24220436-24220450
ATATTTATATATGTATGTATTTCATATTAT24220436TTCATTGACAACATTTACTTGGGAGATTTGTCTCAACAAAAATTA
chr19:39049440-39049454
GAGCCACCACGCCTGGCCTATCTTAGCTTT39049440TTCATTGACAACATTAGTATAATGTTAACAGCTCTCCTAAGGGAG
chrUn_NW_019939645v1:140898-140912
GCATTCATCTCACAGAGGTAAACGTTTCTT140898TTCATTGACAACATTGGGGACTCTGTTCTTGAAGAATCTGCAATG
chr2B:82752700-82752714
AATGCTCCACATTTCATTAAGGGTGATGAC82752700AATGTTGTCAATGAAGAAGTTGCTTTTCATATAACTATAATGTCA
chr3:55176780-55176794
TTTTTTCCACACGAAATCTCCTGATTTCTA55176780AATGTTGTCAATGAATTCTTCCCCTCCCCGCCTTTTTAAAGTAAA
chr4:55358794-55358808
ACTCACTGGATCCAATCAGCATAATGTCAT55358794AATGTTGTCAATGAAAAGAGTTGAACTCTGTAAACTATTTGAAGA
chr5:9866615-9866629
GAGGGCCTTTCCAGCTCCAAAGTCGATGGC9866615AATGTTGTCAATGAAAGATCAGCAGGTCAGTGCATTATACCCAGG
chr8:116180986-116181000
AATCTAGCCTTGAAAGCCCCTTCCAGAGCC116180986AATGTTGTCAATGAAGCTTTCCCTGCTGAATGATAGCTCTCTGGG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/ponAbe3/TTCATTGACAACATT
lang : en | db : ponAbe3 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.080 | 0.072 | search_plus_done; http://172.18.8.77:28767/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.087 | 0.007 | search_minus_done; http://172.18.8.77:28767/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=35
0.088 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).