GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-08-14 23:27:42, GGGenome : Prokaryotic TogoGenome from RefSeq 62 (Nov, 2013)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

rs:NC_019427 Anabaena sp. 90 chromosome chANA01, complete sequence.
taxonomy:"46234", bioproject:"PRJNA179383", refseq:"NC_019427.1"
NC_019427.1:260790-260804
GTCTTGAGATTCCCAATTTTTAATAATATA260790TTCATTGACAACATTATCTAACCAAAACTCTTCATAACCTTTAGC
rs:NC_003030 Clostridium acetobutylicum ATCC 824 chromosome, complete genome.
taxonomy:"272562", bioproject:"PRJNA57677", refseq:"NC_003030.1"
NC_003030.1:2175576-2175590
GGTATTTTATCTTTATTTACAAAAACAGTC2175576TTCATTGACAACATTATTCTCGAAAGTTCTCCTCCTGATACAATT
rs:NC_009085 Acinetobacter baumannii ATCC 17978 chromosome, complete genome.
taxonomy:"400667", bioproject:"PRJNA58731", refseq:"NC_009085.1"
NC_009085.1:1847708-1847722
ATGTTAAGCGATGCACCAGCATTGCAGTCA1847708TTCATTGACAACATTTTGCGCCATGGTCTTGACATCAAGCTTGAA
rs:NC_011026 Chloroherpeton thalassium ATCC 35110 chromosome, complete genome.
taxonomy:"517418", bioproject:"PRJNA59187", refseq:"NC_011026.1"
NC_011026.1:1592376-1592390
CCTCATGAAGCGGGCAGCGGGATTGAGCAG1592376TTCATTGACAACATTCGCAAGCTCAATTTGCACAATTCCATTTTC
rs:NZ_CM000720 Bacillus cereus R309803 chromosome, whole genome shotgun sequence.
taxonomy:"526968", bioproject:"PRJNA55153", refseq:"NZ_CM000720.1"
NZ_CM000720.1:1473351-1473365
ATCGGAACGGTTCCAGCTAACAATACGGTG1473351TTCATTGACAACATTCCAGAAGGGACAATATTCATTGAAGATAGC
rs:NZ_CM000718 Bacillus cereus MM3 chromosome, whole genome shotgun sequence.
taxonomy:"526971", bioproject:"PRJNA55159", refseq:"NZ_CM000718.1"
NZ_CM000718.1:1476543-1476557
ATCGGAACTGTTCCAGCTAACAATACGGTG1476543TTCATTGACAACATTCCAGAAGGTACTATATTCATTGAAGATAGC
rs:NZ_CM000724 Bacillus cereus BDRD-ST26 chromosome, whole genome shotgun sequence.
taxonomy:"526975", bioproject:"PRJNA55167", refseq:"NZ_CM000724.1"
NZ_CM000724.1:1462919-1462933
ATCGGAACGGTTCCAGCTAACAATACGGTG1462919TTCATTGACAACATTCCAGAAGGGACAATATTCATTGAAGATAGC
rs:NZ_CM000727 Bacillus cereus 95/8201 chromosome, whole genome shotgun sequence.
taxonomy:"526979", bioproject:"PRJNA55175", refseq:"NZ_CM000727.1"
NZ_CM000727.1:1501899-1501913
ATAGGAACTGTTCCAGCTAACAACACGGTG1501899TTCATTGACAACATTCCAGAAGGTACTATATTCATTGAAGATAGC
rs:NZ_CM000727 Bacillus cereus 95/8201 chromosome, whole genome shotgun sequence.
taxonomy:"526979", bioproject:"PRJNA55175", refseq:"NZ_CM000727.1"
NZ_CM000727.1:5581958-5581972
ATCGGAACGGTTCCAGCTAACAATACGTTG5581958TTCATTGACAACATTCCAGAAGGGACAATATTCATTGAAGATAGC
rs:NZ_CM000738 Bacillus cereus AH676 chromosome, whole genome shotgun sequence.
taxonomy:"526991", bioproject:"PRJNA55199", refseq:"NZ_CM000738.1"
NZ_CM000738.1:1483117-1483131
ATAGGAACTGTTCCAGCTAACAACACGGTG1483117TTCATTGACAACATTCCAGAAGGTACTATATTCATTGAAGATAGC
rs:NZ_CM000741 Bacillus cereus AH1273 chromosome, whole genome shotgun sequence.
taxonomy:"526994", bioproject:"PRJNA55205", refseq:"NZ_CM000741.1"
NZ_CM000741.1:1500031-1500045
ATCGGAACGGTTCCAGCTAACAATACGGTG1500031TTCATTGACAACATTCCAGAAGGGACAATATTCATTGAAGATAGC
rs:NZ_CM000752 Bacillus thuringiensis serovar monterrey BGSC 4AJ1 chromosome, whole genome shotgun sequence.
taxonomy:"527022", bioproject:"PRJNA55215", refseq:"NZ_CM000752.1"
NZ_CM000752.1:1546920-1546934
ATCGGAACGGTTCCAGCTAACAATACGGTG1546920TTCATTGACAACATTCCAGAAGGGACAATATTCATTGAAGATAGC
rs:NZ_CM000754 Bacillus thuringiensis serovar andalousiensis BGSC 4AW1 chromosome, whole genome shotgun sequence.
taxonomy:"527032", bioproject:"PRJNA55231", refseq:"NZ_CM000754.1"
NZ_CM000754.1:1519586-1519600
ATCGGAACGGTTCCAGCTAACAATACGTTG1519586TTCATTGACAACATTCCAGAAGGGACAATATTCATTGAAGATAGC
rs:NZ_CM000776 Helicobacter canadensis MIT 98-5491 chromosome, whole genome shotgun sequence.
taxonomy:"537970", bioproject:"PRJNA55359", refseq:"NZ_CM000776.2"
NZ_CM000776.2:1253794-1253808
AAAATTTGCAATCAATGCCTCAATGTCTTC1253794TTCATTGACAACATTTTCTGTATTATCACCTTGAATATGCACAGC
rs:NC_012581 Bacillus anthracis str. CDC 684 chromosome, complete genome.
taxonomy:"568206", bioproject:"PRJNA59303", refseq:"NC_012581.1"
NC_012581.1:2712577-2712591
ATCGGAACGGTTCCAGCTAACAATACGGTG2712577TTCATTGACAACATTCCAGAAGGGACAATATTCATTGAAGATAGC
rs:NC_014166 Arcobacter nitrofigilis DSM 7299 chromosome, complete genome.
taxonomy:"572480", bioproject:"PRJNA49001", refseq:"NC_014166.1"
NC_014166.1:634479-634493
TTCAAGAACATTATCAAGAACTACTCTTAC634479TTCATTGACAACATTCTTTGTTGTTGCGACTTTATATTTCTTTGG
rs:NC_014209 Thermoanaerobacter mathranii subsp. mathranii str. A3 chromosome, complete genome.
taxonomy:"583358", bioproject:"PRJNA49481", refseq:"NC_014209.1"
NC_014209.1:695794-695808
ATCCGATATTCTGTTTTTAGTGGATATGGG695794TTCATTGACAACATTTGGAGAAGAAATCGAAAAGGAGTTTGGCAT
rs:NC_017764 Pasteurella multocida subsp. multocida str. 3480 chromosome, complete genome.
taxonomy:"584721", bioproject:"PRJNA161955", refseq:"NC_017764.1"
NC_017764.1:1644073-1644087
CAATTTTAATCTTGTCGCACCTGTCACCAA1644073TTCATTGACAACATTTTCGACATTATCTACTGACACGCCCAAATA
rs:NC_014392 Caldicellulosiruptor obsidiansis OB47 chromosome, complete genome.
taxonomy:"608506", bioproject:"PRJNA51501", refseq:"NC_014392.1"
NC_014392.1:2291756-2291770
GCAGCAACAGAATTGCCTATTATAACATAC2291756TTCATTGACAACATTTCCCCCTTTTTAGACCTCTTTGATTTCAAG
rs:NC_014657 Caldicellulosiruptor owensensis OL chromosome, complete genome.
taxonomy:"632518", bioproject:"PRJNA60165", refseq:"NC_014657.1"
NC_014657.1:2207096-2207110
GCAGCAACAGAATTGCCTATTACAACATAC2207096TTCATTGACAACATTTCCCCCTTTTTTACACCTCTTTGATTTCAA
rs:NC_015589 Desulfotomaculum ruminis DSM 2154 chromosome, complete genome.
taxonomy:"696281", bioproject:"PRJNA67507", refseq:"NC_015589.1"
NC_015589.1:2086166-2086180
ATCACCTCTTTTTTTCAGTAGCGAAATAAC2086166TTCATTGACAACATTCATAAGCTGATCTTCACTGATGCCGCTCTC
rs:NC_014172 Bacillus thuringiensis BMB171 plasmid pBMB171, complete sequence.
taxonomy:"714359", bioproject:"PRJNA49135", refseq:"NC_014172.1"
NC_014172.1:293982-293996
ATAGGAACTGTTCCAGCTAACAACACGGTG293982TTCATTGACAACATTCCAGAAGGTACTATATTCATTGAAGATAGC
rs:NC_017295 Clostridium acetobutylicum EA 2018 chromosome, complete genome.
taxonomy:"863638", bioproject:"PRJNA159515", refseq:"NC_017295.1"
NC_017295.1:2174984-2174998
GGTATTTTATCTTTATTTACAAAAACAGTC2174984TTCATTGACAACATTATTCTCGAAAGTTCTCCTCCTGATACAATT
rs:NC_015388 Desulfobacca acetoxidans DSM 11109 chromosome, complete genome.
taxonomy:"880072", bioproject:"PRJNA65785", refseq:"NC_015388.1"
NC_015388.1:1520322-1520336
GTCCTGTGGGTCAGCGCCATTGCCAGCGCC1520322TTCATTGACAACATTCCCTTCACGGCGACCATGCTGCCCATAGTG
rs:NC_014925 Staphylococcus pseudintermedius HKU10-03 chromosome, complete genome.
taxonomy:"937773", bioproject:"PRJNA62125", refseq:"NC_014925.1"
NC_014925.1:2478572-2478586
TACTGGTCCTGAGTTCGTCTCCATTTTAAG2478572TTCATTGACAACATTAATCGTTGCTGTTGTAACTGCGCGTAAAGG
rs:NC_015687 Clostridium acetobutylicum DSM 1731 chromosome, complete genome.
taxonomy:"991791", bioproject:"PRJNA68293", refseq:"NC_015687.1"
NC_015687.1:2177171-2177185
GGTATTTTATCTTTATTTACAAAAACAGTC2177171TTCATTGACAACATTATTCTCGAAAGTTCTCCTCCTGATACAATT
rs:NC_016808 Pasteurella multocida 36950 chromosome, complete genome.
taxonomy:"1075089", bioproject:"PRJNA86887", refseq:"NC_016808.1"
NC_016808.1:1630845-1630859
CAATTTTAATCTTGTCGCACCTGTCACCAA1630845TTCATTGACAACATTTTCGACATTATCTACTGACACGCCCAAATA
rs:NC_018706 Acinetobacter baumannii TYTH-1 chromosome, complete genome.
taxonomy:"1100841", bioproject:"PRJNA176498", refseq:"NC_018706.1"
NC_018706.1:1514136-1514150
ATGTTAAGTGATGCACCAGCATTGCAGTCA1514136TTCATTGACAACATTTTGCGCCATGGTCTTGACATCAAGCTTGAA
rs:NC_017027 Pasteurella multocida subsp. multocida str. HN06 chromosome, complete genome.
taxonomy:"1132496", bioproject:"PRJNA156881", refseq:"NC_017027.1"
NC_017027.1:1640084-1640098
CAATTTTAATCTTGTCGCACCTGTCACCAA1640084TTCATTGACAACATTTTCGACATTATCTACTGACACGCCCAAATA
rs:NC_018492 Bacillus cereus FRI-35 plasmid p01, complete sequence.
taxonomy:"1217984", bioproject:"PRJNA173403", refseq:"NC_018492.1"
NC_018492.1:213995-214009
ATAGGAACTGTTCCAGCTAACAATACGGTA213995TTCATTGACAACATTCCAGAAGGGACTATATTCATTGAAGATAGC
rs:NC_003997 Bacillus anthracis str. Ames chromosome, complete genome.
taxonomy:"198094", bioproject:"PRJNA57909", refseq:"NC_003997.3"
NC_003997.3:1526492-1526506
GCTATCTTCAATGAATATTGTCCCTTCTGG1526492AATGTTGTCAATGAACACCGTATTGTTAGCTGGAACCGTTCCGAT
rs:NC_005945 Bacillus anthracis str. Sterne chromosome, complete genome.
taxonomy:"260799", bioproject:"PRJNA58091", refseq:"NC_005945.1"
NC_005945.1:1526569-1526583
GCTATCTTCAATGAATATTGTCCCTTCTGG1526569AATGTTGTCAATGAACACCGTATTGTTAGCTGGAACCGTTCCGAT
rs:NC_007530 Bacillus anthracis str. 'Ames Ancestor' chromosome, complete genome.
taxonomy:"261594", bioproject:"PRJNA58083", refseq:"NC_007530.2"
NC_007530.2:1526615-1526629
GCTATCTTCAATGAATATTGTCCCTTCTGG1526615AATGTTGTCAATGAACACCGTATTGTTAGCTGGAACCGTTCCGAT
rs:NC_007355 Methanosarcina barkeri str. Fusaro chromosome, complete genome.
taxonomy:"269797", bioproject:"PRJNA57715", refseq:"NC_007355.1"
NC_007355.1:390172-390186
GATAATGAAGAGGAAATAAATGTTCATCAA390172AATGTTGTCAATGAAGTAATGAAACAATGTAGTATTATTCCGGTA
rs:NC_002663 Pasteurella multocida subsp. multocida str. Pm70 chromosome, complete genome.
taxonomy:"272843", bioproject:"PRJNA57627", refseq:"NC_002663.1"
NC_002663.1:2055298-2055312
TATTTGGGCGTGTCAGTAGATAATGTCGAA2055298AATGTTGTCAATGAATTGGTGACAGGTGCGACAAGATTAAAATTG
rs:NC_005957 Bacillus thuringiensis serovar konkukian str. 97-27 chromosome, complete genome.
taxonomy:"281309", bioproject:"PRJNA58089", refseq:"NC_005957.1"
NC_005957.1:1552756-1552770
GCTATCTTCAATAAATATTGTCCCTTCTGG1552756AATGTTGTCAATGAACACCGTATTGTTAGCTGGAACCGTTCCGAT
rs:NC_006274 Bacillus cereus E33L chromosome, complete genome.
taxonomy:"288681", bioproject:"PRJNA58103", refseq:"NC_006274.1"
NC_006274.1:1551374-1551388
GCTATCTTCAATGAATATAGTCCCTTCTGG1551374AATGTTGTCAATGAACACCGTATTGTTAGCTGGAACCGTTCCGGT
rs:NC_016792 Bacillus cereus NC7401 plasmid pNCcld, complete sequence.
taxonomy:"334406", bioproject:"PRJNA82815", refseq:"NC_016792.1"
NC_016792.1:233936-233950
GCTATCTTCAATGAATATTGTCCCTTCTGG233936AATGTTGTCAATGAACACCGTATTGTTAGCTGGAACCGTTCCGAT
rs:NC_016779 Bacillus cereus F837/76 chromosome, complete genome.
taxonomy:"347495", bioproject:"PRJNA83611", refseq:"NC_016779.1"
NC_016779.1:1502330-1502344
GCTATCTTCAATGAATATTGTCCCTTCTGG1502330AATGTTGTCAATGAACACCGTATTGTTAGCTGGAACCGTTCCGAT
rs:NC_012673 Exiguobacterium sp. AT1b chromosome, complete genome.
taxonomy:"360911", bioproject:"PRJNA59093", refseq:"NC_012673.1"
NC_012673.1:2968404-2968418
GCGGGATTTTTTTATTTTTTGTTGAAAGGA2968404AATGTTGTCAATGAAACCGAAGCTGACCGAGACGGGTCATCACCA
rs:NC_011973 Bacillus cereus Q1 plasmid pBc239, complete sequence.
taxonomy:"361100", bioproject:"PRJNA58529", refseq:"NC_011973.1"
NC_011973.1:78831-78845
GCTATCTTCAATGAATATAGTACCTTCTGG78831AATGTTGTCAATGAACACCGTATTGTTAGCTGGAACAGTTCCTAT
rs:NC_019678 Rivularia sp. PCC 7116 chromosome, complete genome.
taxonomy:"373994", bioproject:"PRJNA182929", refseq:"NC_019678.1"
NC_019678.1:1437160-1437174
AAGGAATTACCGCAAATTAAGGTTTGTACG1437160AATGTTGTCAATGAAAAATATGTTTCGATTTGTATCTCCGATAAT
rs:NC_009659 Janthinobacterium sp. Marseille chromosome, complete genome.
taxonomy:"375286", bioproject:"PRJNA58603", refseq:"NC_009659.1"
NC_009659.1:2054778-2054792
AAGTATTTGGCGACGTCATTCGCAATCGAG2054778AATGTTGTCAATGAACCGCGCGTCATCAGCATTTGTTTGCCGATT
rs:NC_009662 Nitratiruptor sp. SB155-2, complete genome.
taxonomy:"387092", bioproject:"PRJNA58861", refseq:"NC_009662.1"
NC_009662.1:863923-863937
CAAAAAATCGAGCAGCTTCCGCCTATACCA863923AATGTTGTCAATGAATTGCAGGAGTTGTACTATTCAGATATGTAC
rs:NC_011655 Bacillus cereus AH187 plasmid pAH187_270, complete sequence.
taxonomy:"405534", bioproject:"PRJNA58753", refseq:"NC_011655.1"
NC_011655.1:178658-178672
GCTATCTTCAATGAATATTGTCCCTTCTGG178658AATGTTGTCAATGAACACCGTATTGTTAGCTGGAACCGTTCCGAT
rs:NC_011773 Bacillus cereus AH820 chromosome, complete genome.
taxonomy:"405535", bioproject:"PRJNA58751", refseq:"NC_011773.1"
NC_011773.1:1594115-1594129
GCTATCTTCAATGAATATTGTCCCTTCTGG1594115AATGTTGTCAATGAACACCGTATTGTTAGCTGGAACCGTTCCGAT
rs:NC_014228 Xenorhabdus nematophila ATCC 19061 chromosome, complete genome.
taxonomy:"406817", bioproject:"PRJNA49133", refseq:"NC_014228.1"
NC_014228.1:2243844-2243858
TCAGGAGAAATGGCTTCGCCACCCACCATC2243844AATGTTGTCAATGAACGCCACTTTTCTTGAGTTAAGTGCGGCAGT
rs:NC_008600 Bacillus thuringiensis str. Al Hakam chromosome, complete genome.
taxonomy:"412694", bioproject:"PRJNA58795", refseq:"NC_008600.1"
NC_008600.1:1575917-1575931
GCTATCTTCAATGAATATAGTCCCTTCTGG1575917AATGTTGTCAATGAACACCGTATTATTAGCTGGAATAGTTCCTAT
rs:NC_013216 Desulfotomaculum acetoxidans DSM 771 chromosome, complete genome.
taxonomy:"485916", bioproject:"PRJNA59109", refseq:"NC_013216.1"
NC_013216.1:2580031-2580045
TCCTGTACCTTGCCGGTAAAAACATTTTTT2580031AATGTTGTCAATGAATTAAAAGCGGAATTATCATCCATTCTATGA
rs:NZ_CM000716 Bacillus cereus BGSC 6E1 chromosome, whole genome shotgun sequence.
taxonomy:"526970", bioproject:"PRJNA55157", refseq:"NZ_CM000716.1"
NZ_CM000716.1:1452609-1452623
GCTATCTTCAATGAATATTGTCCCTTCTGG1452609AATGTTGTCAATGAACACTGTATTGTTAGCTGGAACCGTTCCGAT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/prok/TTCATTGACAACATT
lang : en | db : prok | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.081 | 0.075 | search_plus_done; http://172.18.8.72:28224/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.102 | 0.021 | search_minus_done; http://172.18.8.72:28224/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=20
0.112 | 0.010 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).