GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-01 01:59:41, GGGenome : Megabat genome, Broad/pteVam1 (Jul, 2008)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

scaffold_1156:249059-249073
CATGATAACGATCTGAGTCATGTAGTTGAG249059TTCATTGACAACATTTAAATAATCCATAGCTCGTTTCCACTGTTC
scaffold_3160:6735-6749
AGTATGCTGCACTCCAAATACTTTTGTGTT6735TTCATTGACAACATTTACTATTACATATACATATGAAAAACAGTC
scaffold_5546:30223-30237
TATGTGTCTTCTTGATGTTCATTTAGGTCA30223TTCATTGACAACATTATGGGAAAAAACTAGACCAGATAAACATTC
scaffold_5957:55128-55142
ACTGCATATTTAAAACAAATTTAGTTTCTT55128TTCATTGACAACATTGGAGAAGAAAAAAATATTATTTTAGAATAC
scaffold_6037:40166-40180
CTCACCCAAAGGGTTGGGTAACAGGGAAAT40166TTCATTGACAACATTTGGGCAAAAGTATTTGGGGAGATGCCCTTT
scaffold_15051:3485-3499
GTTAAAAAGAACAAACCGATTCAAGGTTTG3485TTCATTGACAACATTCCAGTGAGAGTCGAAAATGGTATAAGAGCC
scaffold_25484:8465-8479
TCTGTTAAAAACACTGATAGAACTCATATT8465TTCATTGACAACATTACATCATTTCTAAGAAGATTTAATAACCTT
scaffold_2419:35072-35086
TCACAACTGAGACCAGCTTTCAGCAGTGAG35072AATGTTGTCAATGAAATAATGTTGACATAAGTACTATAGGTGAAA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/pteVam1/TTCATTGACAACATT
lang : en | db : pteVam1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.078 | 0.071 | search_plus_done; http://172.18.8.78:28042/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.083 | 0.005 | search_minus_done; http://172.18.8.78:28042/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=43
0.083 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).