GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2024-03-03 13:42:54, GGGenome : RefSeq complete RNA release 220 (Sep, 2023)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Talaromyces stipitatus ATCC 10500 ATP synthase F1, beta subunit, putative, mRNA
XM_002484711.1:915-929
CGTGACGAGGAAGGTCAAGACGTGCTTCTC915TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCTGAGGTG
Penicillium chrysogenum Wisconsin 54-1255 hypothetical protein (Pc21g10070) mRNA, complete cds
XM_002567996.1:871-885
CGTGACCAGGAGGGTCAAGATGTGCTGCTC871TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCCGAGGTG
Uncinocarpus reesii 1704 ATP synthase F1, beta subunit, mRNA
XM_002544546.1:880-894
CGTGATGAGGAGGGCCAAGACGTGCTTCTC880TTCATTGACAACATTTTCCGTTTCACTCAAGCTGGTTCCGAAGTG
PREDICTED: Camelina sativa ATP synthase subunit beta-1, mitochondrial-like (LOC104734902), mRNA
XM_010454580.1:1041-1055
CGTGATGCCGAAGGCCAAGACGTGTTGCTT1041TTCATTGACAACATTTTCCGTTTCACTCAGGCCAACTCTGAAGTG
PREDICTED: Camelina sativa uncharacterized LOC104734904 (LOC104734904), mRNA
XM_010454586.2:1082-1096
CGTGATGCCGAAGGCCAAGATGTGTTGCTT1082TTCATTGACAACATTTTCCGTTTCACTCAGGCCAACTCTGAAGTG
PREDICTED: Camelina sativa uncharacterized LOC104734904 (LOC104734904), mRNA
XM_010454586.2:2780-2794
CGTGATGCCGAAGGCCAAGACGTGTTGCTT2780TTCATTGACAACATTTTCCGTTTCACTCAGGCCAACTCTGAAGTG
PREDICTED: Camelina sativa ATP synthase subunit beta-1, mitochondrial-like (LOC104769091), mRNA
XM_010493220.2:1018-1032
CGTGATGCCGAAGGCCAAGACGTGTTGCTT1018TTCATTGACAACATTTTCCGTTTCACTCAGGCCAACTCTGAAGTG
PREDICTED: Camelina sativa ATP synthase subunit beta-3, mitochondrial (LOC104708209), transcript variant X1, mRNA
XM_010424727.2:1095-1109
CGTGATGCTGAAGGCCAAGATGTGTTGCTT1095TTCATTGACAACATTTTCCGTTTCACTCAGGCCAACTCTGAAGTG
PREDICTED: Camelina sativa ATP synthase subunit beta-3, mitochondrial (LOC104708209), transcript variant X2, mRNA
XM_010424728.2:1095-1109
CGTGATGCTGAAGGCCAAGATGTGTTGCTT1095TTCATTGACAACATTTTCCGTTTCACTCAGGCCAACTCTGAAGTG
PREDICTED: Camelina sativa ATP synthase subunit beta-1, mitochondrial (LOC104708210), transcript variant X2, mRNA
XM_019228900.1:1035-1049
CGTGATGCCGAAGGCCAAGATGTGTTGCTT1035TTCATTGACAACATTTTCCGTTTCACTCAGGCCAACTCTGAAGTG
PREDICTED: Camelina sativa ATP synthase subunit beta-1, mitochondrial (LOC104708208), mRNA
XM_010424726.2:1016-1030
CGTGATGCCGAAGGCCAAGATGTGTTGCTT1016TTCATTGACAACATTTTCCGTTTCACTCAGGCCAACTCTGAAGTG
PREDICTED: Ipomoea nil ATP synthase subunit beta, mitochondrial-like (LOC109157609), mRNA
XM_019305461.1:1139-1153
AGAGATGCTGAGGGTCAGGATGTGCTTCTT1139TTCATTGACAACATTTTCAGGTTCACACAGGCCAACTCAGAAGTG
PREDICTED: Nicotiana attenuata ATP synthase subunit beta, mitochondrial-like (LOC109216961), mRNA
XM_019381185.1:1107-1121
AGAGATGCTGAGGGACAGGATGTGCTTCTC1107TTCATTGACAACATTTTCAGATTTACCCAGGCTAACTCAGAGGTG
PREDICTED: Hippocampus comes insulin receptor substrate 1-B-like (LOC109512406), mRNA
XM_019864145.1:3150-3164
GGAAAGACGGCAGGAGACGCCCACAGTTCG3150TTCATTGACAACATTTCGGATCCCGGCCTTTCAGCGAGACCTGTC
PREDICTED: Hippocampus comes ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide (atp5b), mRNA
XM_019868531.1:915-929
CGTGACCAAGAGGGTCAGGACGTGCTGCTC915TTCATTGACAACATTTTCCGCTTCACACAAGCTGGCTCTGAGGTG
PREDICTED: Ananas comosus ATP synthase subunit beta, mitochondrial (LOC109716435), mRNA
XM_020241881.1:1113-1127
CGTGATGCCGAAGGGCAAGATGTGCTCCTT1113TTCATTGACAACATTTTCCGCTTCACCCAAGCGAACTCAGAAGTG
PREDICTED: Asparagus officinalis probable leucine-rich repeat receptor-like protein kinase At5g49770 (LOC109823692), mRNA
XM_020390027.1:1480-1494
AGATGCTCCTCCGTGGTTCTCCACATTGCC1480TTCATTGACAACATTGTATTTAGAAAATTTAAGGATTGGGGGGCA
Polysphondylium pallidum PN500 hypothetical protein partial mRNA
XM_020572573.1:363-377
CAATAAACTAGATTATAAAGGTTCAATACT363TTCATTGACAACATTGTCTACACCACATAGAGGTAGTTATATTGC
PREDICTED: Amborella trichopoda ATP synthase subunit beta, mitochondrial (LOC18433796), mRNA
XM_006843881.3:1298-1312
AGAGATGCTGAAGGCCAAGATGTGCTTCTC1298TTCATTGACAACATTTTCCGTTTCACCCAAGCAAACTCTGAAGTG
PREDICTED: Pogona vitticeps ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide (ATP5B), mRNA
XM_020784638.1:960-974
AGAGACCAAGAGGGGCAGGATGTATTGCTT960TTCATTGACAACATTTTCCGTTTCACACAGGCTGGGTCTGAGGTG
PREDICTED: Odocoileus virginianus texanus dynein heavy chain 5, axonemal-like (LOC110141408), mRNA
XM_020900314.1:451-465
ATCATCAGGGTGAAGCTGGCCAGTTGTGGC451TTCATTGACAACATTGTTTTGGCCAGGAAGTTTTTCACACTCTAC
PREDICTED: Drosophila serrata uncharacterized LOC110182939 (LOC110182939), ncRNA
XR_002319591.1:293-307
ACTAAGCAATACCGGCTAATATCGCTCCGT293TTCATTGACAACATTTAGATTTTCCTGTGGAAAACATTTCCCATC
PREDICTED: Drosophila serrata plexin-A4 (LOC110185457), mRNA
XM_020954300.1:6810-6824
CGTGATCAGGAGGGACAGGATGTTCTCCTC6810TTCATTGACAACATTTTTAGGTTCACGCAGGCTGGTTCCGAAGTG
PREDICTED: Arabidopsis lyrata subsp. lyrata ATP synthase subunit beta-1, mitochondrial (LOC9307425), mRNA
XM_002873330.2:1074-1088
CGTGATGCCGAAGGCCAAGACGTCTTGCTT1074TTCATTGACAACATTTTCCGTTTCACTCAGGCCAACTCTGAAGTG
Cyphellophora europaea CBS 101466 ATP synthase subunit beta, mitochondrial partial mRNA
XM_008715668.1:1486-1500
AGAGACGAAGAAGGTCAAGATGTGTTGCTC1486TTCATTGACAACATTTTCCGCTTCACTCAGGCCGGTTCTGAAGTG
PREDICTED: Heterocephalus glaber dynein axonemal heavy chain 5 (Dnah5), transcript variant X1, mRNA
XM_013072408.2:7215-7229
ATCATAAGGGTGAAGCTAGCCAGTTGTGGC7215TTCATTGACAACATTGTTCTGGCCAGGAAGTTTTTCACACTATAC
PREDICTED: Heterocephalus glaber dynein axonemal heavy chain 5 (Dnah5), transcript variant X2, mRNA
XM_021258622.1:6570-6584
ATCATAAGGGTGAAGCTAGCCAGTTGTGGC6570TTCATTGACAACATTGTTCTGGCCAGGAAGTTTTTCACACTATAC
PREDICTED: Heterocephalus glaber dynein axonemal heavy chain 5 (Dnah5), transcript variant X3, mRNA
XM_021258623.1:7218-7232
ATCATAAGGGTGAAGCTAGCCAGTTGTGGC7218TTCATTGACAACATTGTTCTGGCCAGGAAGTTTTTCACACTATAC
Kazachstania africana CBS 2517 hypothetical protein (KAFR0K00700), partial mRNA
XM_003959511.1:2158-2172
ATAGCAGCAATTAGTAAGTCACTAGCAAAA2158TTCATTGACAACATTCGTGATGAGTCGTCACAAAACTCTGCAGAT
Naumovozyma dairenensis CBS 421 hypothetical protein (NDAI0J02660), partial mRNA
XM_003672353.1:42-56
GAAGATAATACTGCTGTCGTCATGTCTGTT42TTCATTGACAACATTCCTTTTGGTTATCATAGCGACTGCTGGTTC
PREDICTED: Mizuhopecten yessoensis ATP synthase subunit beta, mitochondrial (LOC110452283), mRNA
XM_021500702.1:927-941
CGTGATCAGGAGGGACAGGACGTACTGCTC927TTCATTGACAACATTTTCAGATTCACACAGGCAGGCTCAGAGGTG
PREDICTED: Meriones unguiculatus coronin 2B (Coro2b), transcript variant X1, mRNA
XM_021640478.1:666-680
GGCAATGTGCTGGACATCAAATGGAACCCC666TTCATTGACAACATTATCGCCTCGTGCTCCGAGGACACTTCGGTG
PREDICTED: Meriones unguiculatus coronin 2B (Coro2b), transcript variant X2, mRNA
XM_021640479.1:295-309
GGCAATGTGCTGGACATCAAATGGAACCCC295TTCATTGACAACATTATCGCCTCGTGCTCCGAGGACACTTCGGTG
Wallemia mellicola CBS 633.66 beta subunit of the F1 sector of mitochondrial F1F0 ATP synthase mRNA
XM_006958912.1:1477-1491
CGTGATGACGAAGGTCAAGATGTCTTGCTC1477TTCATTGACAACATTTTCCGTTTCACTCAAGCAGGTTCTGAGGTC
PREDICTED: Aedes aegypti ATP synthase subunit beta, mitochondrial (LOC5577999), mRNA
XM_001656687.2:919-933
CGTGATCAGGAAGGACAGGATGTGCTGCTC919TTCATTGACAACATTTTCCGTTTCACCCAAGCTGGTTCTGAGGTA
PREDICTED: Aedes aegypti ATP synthase subunit beta, mitochondrial (LOC5576214), mRNA
XM_001655941.2:1037-1051
CGCGATCAAGAGGGACAGGATGTGCTGCTC1037TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCCGAGGTA
PREDICTED: Chenopodium quinoa uncharacterized LOC110707360 (LOC110707360), mRNA
XM_021885383.1:823-837
TGTGACATAGAACTACCTGATCCTGACGTC823TTCATTGACAACATTGACTGGGATTCCAATGTCGATCCCAGTCTT
PREDICTED: Zootermopsis nevadensis ATP synthase subunit beta, mitochondrial (LOC110837409), mRNA
XM_022079501.1:949-963
CGAGACCAAGAAGGACAGGATGTGCTGCTG949TTCATTGACAACATTTTCAGGTTCACCCAAGCTGGTTCAGAGGTA
PREDICTED: Momordica charantia ATP synthase subunit beta, mitochondrial (LOC111018677), mRNA
XM_022294875.1:1084-1098
CGTGATGCTGAAGGGCAAGATGTGCTTCTC1084TTCATTGACAACATTTTCCGTTTTACCCAGGCTAATTCAGAGGTG
PREDICTED: Momordica charantia ATP synthase subunit beta, mitochondrial-like (LOC111020045), mRNA
XM_022296600.1:1072-1086
CGTGATGCTGAAGGACAGGATGTGCTTCTC1072TTCATTGACAACATTTTCCGCTTTACCCAGGCTAACTCTGAGGTG
Cryptococcus amylolentus CBS 6039 ATP synthase subunit beta, mitochondrial (L202_03082), mRNA
XM_019136867.1:970-984
CGTGATGACGAAGGCCAGGATGTGTTGCTC970TTCATTGACAACATTTTCCGATTCACCCAGGCCGGTTCCGAGGTG
Cryptococcus amylolentus CBS 6039 ATP synthase subunit beta, mitochondrial, variant 1 (L202_03082), mRNA
XM_019136868.1:1124-1138
CGTGATGACGAAGGCCAGGATGTGTTGCTC1124TTCATTGACAACATTTTCCGATTCACCCAGGCCGGTTCCGAGGTG
Cryptococcus amylolentus CBS 6039 ATP synthase subunit beta, mitochondrial, variant 2 (L202_03082), mRNA
XM_019136869.1:1172-1186
CGTGATGACGAAGGCCAGGATGTGTTGCTC1172TTCATTGACAACATTTTCCGATTCACCCAGGCCGGTTCCGAGGTG
Isaria fumosorosea ARSEF 2679 ATP synthase beta chain (ISF_06605), partial mRNA
XM_018850209.1:871-885
CGTGATCAGGAAGGCCAGGACGTGCTGCTC871TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCCGAAGTG
Diplodia corticola atp synthase subunit mitochondrial (BKCO1_4700039), partial mRNA
XM_020276390.1:871-885
CGTGATGAGGAGGGCCAGGACGTGCTTCTC871TTCATTGACAACATTTTCCGTTTCACTCAGGCCGGTTCCGAGGTG
Penicillium expansum ATPase, F1 complex beta subunit/V1 complex, C-terminal (PEX2_107420), partial mRNA
XM_016748010.1:874-888
CGTGACGAGGAGGGTCAGGACGTGCTGCTC874TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCCGAGGTG
Scedosporium apiospermum Sodium-transporting two-sector ATPase (SAPIO_CDS2824), partial mRNA
XM_016785748.1:862-876
CGTGATGAGGAGGGTCAGGATGTGCTTCTC862TTCATTGACAACATTTTCCGATTCACTCAGGCCGGTTCCGAGGTG
Talaromyces atroroseus ATP synthase subunit beta, mitochondrial (UA08_08849), partial mRNA
XM_020263894.1:877-891
CGTGATGAGGAGGGTCAGGATGTGCTTCTC877TTCATTGACAACATTTTCCGTTTCACCCAAGCCGGTTCTGAGGTG
Tsuchiyaea wingfieldii CBS 7118 ATP synthase subunit beta, mitochondrial (L198_01376), partial mRNA
XM_019173539.1:964-978
CGTGATGACGAAGGTCAGGATGTGTTGCTC964TTCATTGACAACATTTTCCGATTCACCCAGGCCGGTTCCGAGGTG
Kockovaella imperatae putative ATP synthase beta chain mitochondrial precursor (BD324DRAFT_618644), mRNA
XM_022015060.1:1029-1043
CGAGACGAGGAGGGACAGGATGTGTTGCTT1029TTCATTGACAACATTTTCCGATTCACCCAAGCCGGTTCCGAAGTG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/refseq220/TTCATTGACAACATT
lang : en | db : refseq220 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.159 | 0.151 | search_plus_done; http://172.18.8.135:28957/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.208 | 0.048 | search_minus_done; http://172.18.8.135:28957/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=0
0.208 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).