GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-12-01 12:55:16, GGGenome : RefSeq complete RNA release 70 (May, 2015)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

PREDICTED: Equus caballus activating signal cointegrator 1 complex subunit 1 (ASCC1), mRNA
XM_001503779.4:730-744
TGTGAGATGCTACAGCAGTGTAAAGAGGAA730TTCATTGACAACATTTGTCGGGGCAAACCCCTGGAAGTAGAGATG
PREDICTED: Xiphophorus maculatus homeobox protein engrailed-1-like (LOC102232149), mRNA
XM_005813508.1:100-114
GGCCCACAGAACCACAGAACAACAAACTTC100TTCATTGACAACATTTTACGGCCGGATTTCGGATGCAAGAGGGAA
PREDICTED: Myotis brandtii dynein, axonemal, heavy chain 5 (DNAH5), partial mRNA
XM_005871062.1:6304-6318
ATCATAAGGGTGAAGTTGGCTAGCTGCGGC6304TTCATTGACAACATTGTTTTGGCCAGGAAGTTTTTCACGCTCTAC
PREDICTED: Haplochromis burtoni homeobox protein engrailed-1-like (LOC102310207), transcript variant X1, mRNA
XM_005943398.1:373-387
GCCCAACAGGCCCACAGAACCACCAACTTT373TTCATTGACAACATTTTGAGACCGGACTTTGGCTGCAAGAAGGAG
PREDICTED: Haplochromis burtoni homeobox protein engrailed-1-like (LOC102310207), transcript variant X2, mRNA
XM_005943399.1:373-387
GCCCAACAGGCCCACAGAACCACCAACTTT373TTCATTGACAACATTTTGAGACCGGACTTTGGCTGCAAGAAGGAG
PREDICTED: Haplochromis burtoni homeobox protein engrailed-1-like (LOC102310207), transcript variant X3, mRNA
XM_005943400.1:373-387
GCCCAACAGGCCCACAGAACCACCAACTTT373TTCATTGACAACATTTTGAGACCGGACTTTGGCTGCAAGAAGGAG
PREDICTED: Latimeria chalumnae dynein, axonemal, heavy chain 5 (DNAH5), mRNA
XM_006002477.1:6466-6480
ATCATTCGTGTGAAGCTCGCTAGCTGTGGT6466TTCATTGACAACATTGTGCTGGCTAGAAAGTTCTTTACTCTTTAC
PREDICTED: Myotis lucifugus dynein, axonemal, heavy chain 5 (DNAH5), mRNA
XM_006081581.1:6616-6630
ATCATAAGGGTGAAGTTGGCTAGCTGTGGC6616TTCATTGACAACATTGTTTTGGCCAGGAAGTTTTTCACGCTCTAC
PREDICTED: Tupaia chinensis dynein, axonemal, heavy chain 5 (DNAH5), mRNA
XM_006165253.1:6739-6753
ATCATAAGGGTGAAGCTGGCGAGCTGTGGT6739TTCATTGACAACATTGTTTTGGCCAGGAAGTTTTTCACACTCTAC
Populus trichocarpa hypothetical protein (POPTR_0002s00850g) mRNA, complete cds
XM_002300597.2:1354-1368
AAATGGGATGAAAAGATGGAAGAAGCTGCA1354TTCATTGACAACATTGGCTGCTACAGGCGTTATACGTTTGATAGT
Populus trichocarpa hypothetical protein (POPTR_0008s05260g) mRNA, complete cds
XM_002312041.2:3247-3261
CTCCCAGTTTGCGAACCATTATCTAGACGA3247TTCATTGACAACATTGAGAAGCCAAAAGTTCAGCAGCTAATCAGT
Populus trichocarpa H+-transporting two-sector ATPase family protein (POPTR_0008s12550g) mRNA, complete cds
XM_002311447.2:1108-1122
CGTGATGCTGAAGGGCAAGATGTGCTTCTC1108TTCATTGACAACATTTTCCGCTTTACCCAGGCTAACTCAGAGGTG
Populus trichocarpa H+-transporting two-sector ATPase family protein (POPTR_0010s12680g) mRNA, complete cds
XM_002315866.2:1104-1118
CGTGATGCTGAAGGGCAAGATGTGCTTCTA1104TTCATTGACAACATTTTCCGCTTTACCCAGGCTAACTCAGAGGTG
PREDICTED: Glycine max uncharacterized LOC102666232 (LOC102666232), mRNA
XM_006573972.1:229-243
TTGGATCAATTTCATCCATTTATACATGAT229TTCATTGACAACATTGTGGATGTCAAAGCTGACAATAACTGTGGA
PREDICTED: Glycine max uncharacterized LOC102659908 (LOC102659908), transcript variant X1, mRNA
XM_006593741.1:259-273
TTGGATCAATTTCAGCCATTTATCCACGAC259TTCATTGACAACATTATTGATGTCAAAGCTGATAAAAACTGTGGA
PREDICTED: Glycine max uncharacterized LOC102659908 (LOC102659908), transcript variant X2, mRNA
XM_006593742.1:259-273
TTGGATCAATTTCAGCCATTTATCCACGAC259TTCATTGACAACATTATTGATGTCAAAGCTGATAAAAACTGTGGA
PREDICTED: Glycine max uncharacterized LOC102667549 (LOC102667549), mRNA
XM_006597861.1:733-747
TTGGATCAATTTCAGCCATTTATACATGAT733TTCATTGACAACATTGTGGATGTCAAAGCTGACGGTAACTGTGGA
PREDICTED: Oryza brachyantha ATP synthase subunit beta, mitochondrial-like (LOC102711701), mRNA
XM_006654690.1:698-712
CGTGATGCTGAAGGACAAGATGTGCTTCTG698TTCATTGACAACATTTTCCGTTTCACTCAGGCAAACTCTGAGGTG
PREDICTED: Oryza brachyantha SNF2 domain-containing protein CLASSY 2-like (LOC102718476), mRNA
XM_006658934.1:1785-1799
GCTTGAAGAACTGTGGAAAGAAATGGATTA1785TTCATTGACAACATTAGCACTTCTCGAGAAAAAGCAGGTGACGAC
Agaricus bisporus var. bisporus H97 ATP2 beta subunit of the F1 sector of mitochondrial F1F0 ATP synthase (AGABI2DRAFT_190409), mRNA
XM_006457965.1:1000-1014
CGTGATGAAGAAGGTCAGGATGTGTTGCTC1000TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCCGAGGTG
Cordyceps militaris CM01 ATP synthase beta chain (CCM_07426), partial mRNA
XM_006672567.1:871-885
CGTGATGAGGAAGGTCAGGACGTGCTGCTC871TTCATTGACAACATTTTCCGTTTCACTCAGGCTGGTTCTGAGGTG
Batrachochytrium dendrobatidis JAM81 hypothetical protein (BATDEDRAFT_20257), mRNA
XM_006680239.1:854-868
CGTGATCAAGAAGGCCAGGATGTGTTGCTT854TTCATTGACAACATTTTCCGTTTCACTCAGGCCGGTTCTGAGGTG
Arabidopsis thaliana ATP synthase subunit beta-1 mRNA, complete cds
NM_120953.3:1018-1032
CGTGATGCTGAAGGCCAAGACGTTTTGCTT1018TTCATTGACAACATTTTCCGTTTCACTCAGGCCAACTCTGAAGTG
Arabidopsis thaliana ATP synthase subunit beta-2 mRNA, complete cds
NM_120954.2:1017-1031
CGTGATGCTGAAGGCCAAGATGTCTTGCTT1017TTCATTGACAACATTTTCCGTTTCACTCAGGCCAACTCTGAAGTG
PREDICTED: Neolamprologus brichardi homeobox protein engrailed-1-like (LOC102789766), mRNA
XM_006806441.1:359-373
GCCCAACAGGCCCACAGAACCACCAACTTT359TTCATTGACAACATTTTGAGACCGGACTTTGGCTGCAAGAAGGAG
PREDICTED: Neolamprologus brichardi histone-lysine N-methyltransferase SUV39H1-like (LOC102791492), mRNA
XM_006807165.1:1030-1044
TGTAACCCTAACCTGCAGGTATACAACGTG1030TTCATTGACAACATTGACGAAAGGCTTCCGAGAATTGCGTTATTT
PREDICTED: Myotis davidii dynein, axonemal, heavy chain 5 (DNAH5), mRNA
XM_006769481.1:6367-6381
ATCATAAGGGTGAAGTTGGCTAGCTGTGGC6367TTCATTGACAACATTGTTTTGGCCAGGAAGTTTTTCACGCTCTAC
PREDICTED: Chrysochloris asiatica coronin, actin binding protein, 2B (CORO2B), mRNA
XM_006866553.1:277-291
GGCAACGTGCTGGACATCAAGTGGAACCCC277TTCATTGACAACATTATCGCCTCATGTTCAGAGGACACCTCCGTG
Wallemia sebi CBS 633.66 beta subunit of the F1 sector of mitochondrial F1F0 ATP synthase (WALSEDRAFT_32961), mRNA
XM_006958912.1:1477-1491
CGTGATGACGAAGGTCAAGATGTCTTGCTC1477TTCATTGACAACATTTTCCGTTTCACTCAAGCAGGTTCTGAGGTC
Tremella mesenterica DSM 1558 hypothetical protein (TREMEDRAFT_41300), mRNA
XM_007008209.1:1032-1046
CGTGACGAAGAGGGTCAGGATGTGTTGCTC1032TTCATTGACAACATTTTCCGATTCACCCAGGCCGGTTCCGAGGTG
PREDICTED: Physeter catodon dynein, axonemal, heavy chain 5 (DNAH5), mRNA
XM_007127169.1:6420-6434
ATCATCAGGGTGAAGTTGGCTAGTTGCGGC6420TTCATTGACAACATTGTTTTGGCCAGGAAGTTTTTCACGCTCTAC
PREDICTED: Balaenoptera acutorostrata scammoni dynein, axonemal, heavy chain 5 (DNAH5), mRNA
XM_007188253.1:6387-6401
ATCATCAGGGTGAAGTTGGCTAGTTGCGGC6387TTCATTGACAACATTGTTTTGGCCAGGAAGTTTTTCACGCTCTAC
Colletotrichum gloeosporioides Nara gc5 ATP synthase beta (CGGC5_13870), partial mRNA
XM_007286033.1:871-885
CGTGACGAGGAGGGACAGGATGTGTTGCTT871TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCTGAGGTG
Agaricus bisporus var. burnettii JB137-S8 ATP2 beta subunit of the F1 sector of mitochondrial F1F0 ATP synthase (AGABI1DRAFT_111188), mRNA
XM_007326499.1:1000-1014
CGTGATGAAGAAGGTCAGGATGTGTTGCTC1000TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCCGAGGTG
Melampsora larici-populina 98AG31 hypothetical protein (MELLADRAFT_45062), mRNA
XM_007415010.1:1070-1084
CGTGACGAAGAGGGACAAGATGTGCTTTTG1070TTCATTGACAACATTTTCCGATTCACCCAAGCTGGTTCCGAGGTA
Neofusicoccum parvum UCRNP2 putative -alpha-glucan-branching enzyme protein mRNA
XM_007581450.1:2986-3000
CGTGATGAGGAGGGCCAGGATGTGCTTCTC2986TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCCGAGGTG
PREDICTED: Poecilia formosa homeobox protein engrailed-1-B-like (LOC103154097), mRNA
XM_007575258.1:118-132
GGCCCACAGACCAACAGAACAACAAACTTC118TTCATTGACAACATTTTGAGGCCGGATTTCGGATGCAAGAAGGAA
PREDICTED: Poecilia formosa suppressor of variegation 3-9 homolog 1 (Drosophila) (suv39h1), transcript variant X1, mRNA
XM_007575422.1:1096-1110
TGTAACCCAAACCTGCAGGTCTTCAATGTG1096TTCATTGACAACATTGACGAGAGGCTTCCCAGAATCGCTTTATTT
PREDICTED: Poecilia formosa suppressor of variegation 3-9 homolog 1 (Drosophila) (suv39h1), transcript variant X2, misc_RNA
XR_477896.1:1096-1110
TGTAACCCAAACCTGCAGGTCTTCAATGTG1096TTCATTGACAACATTGACGAGAGGCTTCCCAGAATCGCTTTATTT
PREDICTED: Erinaceus europaeus dynein, axonemal, heavy chain 5 (DNAH5), mRNA
XM_007524224.1:6451-6465
ATCATACGGGTGAAGCTGGCCAGCTGCGGA6451TTCATTGACAACATTGTTCTGGCCCGGAAGTTCTTCACGCTCTAC
PREDICTED: Ornithorhynchus anatinus dynein, axonemal, heavy chain 5 (DNAH5), mRNA
XM_007659730.1:6289-6303
ATCATTCGGGTGAAGCTGGCCAGCTGTGGT6289TTCATTGACAACATTGTTCTGGCAAGAAAATTTTTCACCTTGTAC
Coniophora puteana RWD-64-598 SS2 ATP synthase F1 beta subunit mRNA
XM_007766058.1:968-982
CGTGACGAGGAGGGCCAGGACGTGCTTCTG968TTCATTGACAACATTTTCCGCTTCACGCAAGCCGGTTCCGAGGTA
Coniophora puteana RWD-64-598 SS2 hypothetical protein partial mRNA
XM_007775178.1:2305-2319
ATGAACGAAGTCAAAGAGTCGGCTCAAAGC2305TTCATTGACAACATTCAGAGGAGAACGGTCTTTGTTTCCCAAAAC
Endocarpon pusillum Z07020 ATP synthase subunit beta mRNA
XM_007802133.1:979-993
CGTGACGAGGAAGGACAGGACGTGCTGCTC979TTCATTGACAACATTTTCCGATTCACCCAGGCTGGTTCTGAGGTG
Eutypa lata UCREL1 putative atp synthase beta mitochondrial precursor protein mRNA
XM_007795522.1:856-870
CGTGACGAGGAAGGCCAGGATGTGCTTCTC856TTCATTGACAACATTTTCCGTTTCACTCAAGCCGGTTCTGAGGTG
Metarhizium acridum CQMa 102 ATP synthase beta chain precursor partial mRNA
XM_007816203.1:1081-1095
CGTGACCAGGAAGGCCAGGATGTGCTGCTC1081TTCATTGACAACATTTTCCGATTCACTCAGGCCGGCTCTGAGGTG
Pestalotiopsis fici W106-1 ATP synthase subunit beta mRNA
XM_007837839.1:871-885
CGTGACGCCGAGGGACAGGATGTGCTGCTC871TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCCGAGGTG
PREDICTED: Eptesicus fuscus dynein, axonemal, heavy chain 5 (DNAH5), mRNA
XM_008151678.1:6367-6381
ATCATAAGAGTGAAGCTGGCTAGCTGTGGC6367TTCATTGACAACATTGTGTTGGCCAGGAAGTTTTTCACGCTCTAC
PREDICTED: Nasonia vitripennis speckle-type POZ protein-like (LOC100679355), mRNA
XM_003425024.2:127-141
AGAATAATTTTACTGATATTTTACTCGGTT127TTCATTGACAACATTTCTGTCTGACTGTTCCAGGTACAAAAAAAA
PREDICTED: Nasonia vitripennis speckle-type POZ protein B-like (LOC100679398), transcript variant X1, mRNA
XM_003425025.2:2006-2020
AGAATAATTTTACTGATATTTTACTCGGTT2006TTCATTGACAACATTTCTGTCTGAGTA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/refseq70/TTCATTGACAACATT
lang : en | db : refseq70 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.170 | 0.163 | search_plus_done; http://172.18.8.74:28689/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.205 | 0.035 | search_minus_done; http://172.18.8.74:28689/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=0
0.205 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).