GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-12-01 11:57:39, GGGenome : RefSeq complete RNA release 80 (Jan, 2017)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Populus trichocarpa hypothetical protein (POPTR_0002s00850g) mRNA, complete cds
XM_002300597.2:1354-1368
AAATGGGATGAAAAGATGGAAGAAGCTGCA1354TTCATTGACAACATTGGCTGCTACAGGCGTTATACGTTTGATAGT
Populus trichocarpa hypothetical protein (POPTR_0008s05260g) mRNA, complete cds
XM_002312041.2:3247-3261
CTCCCAGTTTGCGAACCATTATCTAGACGA3247TTCATTGACAACATTGAGAAGCCAAAAGTTCAGCAGCTAATCAGT
Populus trichocarpa H+-transporting two-sector ATPase family protein (POPTR_0008s12550g) mRNA, complete cds
XM_002311447.2:1108-1122
CGTGATGCTGAAGGGCAAGATGTGCTTCTC1108TTCATTGACAACATTTTCCGCTTTACCCAGGCTAACTCAGAGGTG
Populus trichocarpa H+-transporting two-sector ATPase family protein (POPTR_0010s12680g) mRNA, complete cds
XM_002315866.2:1104-1118
CGTGATGCTGAAGGGCAAGATGTGCTTCTA1104TTCATTGACAACATTTTCCGCTTTACCCAGGCTAACTCAGAGGTG
Agaricus bisporus var. bisporus H97 ATP2 beta subunit of the F1 sector of mitochondrial F1F0 ATP synthase (AGABI2DRAFT_190409), mRNA
XM_006457965.1:1000-1014
CGTGATGAAGAAGGTCAGGATGTGTTGCTC1000TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCCGAGGTG
Cordyceps militaris CM01 ATP synthase beta chain (CCM_07426), partial mRNA
XM_006672567.1:871-885
CGTGATGAGGAAGGTCAGGACGTGCTGCTC871TTCATTGACAACATTTTCCGTTTCACTCAGGCTGGTTCTGAGGTG
Batrachochytrium dendrobatidis JAM81 hypothetical protein (BATDEDRAFT_20257), mRNA
XM_006680239.1:854-868
CGTGATCAAGAAGGCCAGGATGTGTTGCTT854TTCATTGACAACATTTTCCGTTTCACTCAGGCCGGTTCTGAGGTG
PREDICTED: Neolamprologus brichardi homeobox protein engrailed-1-like (LOC102789766), mRNA
XM_006806441.1:359-373
GCCCAACAGGCCCACAGAACCACCAACTTT359TTCATTGACAACATTTTGAGACCGGACTTTGGCTGCAAGAAGGAG
PREDICTED: Neolamprologus brichardi histone-lysine N-methyltransferase SUV39H1-like (LOC102791492), mRNA
XM_006807165.1:1030-1044
TGTAACCCTAACCTGCAGGTATACAACGTG1030TTCATTGACAACATTGACGAAAGGCTTCCGAGAATTGCGTTATTT
PREDICTED: Chrysochloris asiatica coronin, actin binding protein, 2B (CORO2B), mRNA
XM_006866553.1:277-291
GGCAACGTGCTGGACATCAAGTGGAACCCC277TTCATTGACAACATTATCGCCTCATGTTCAGAGGACACCTCCGTG
Wallemia sebi CBS 633.66 beta subunit of the F1 sector of mitochondrial F1F0 ATP synthase (WALSEDRAFT_32961), mRNA
XM_006958912.1:1477-1491
CGTGATGACGAAGGTCAAGATGTCTTGCTC1477TTCATTGACAACATTTTCCGTTTCACTCAAGCAGGTTCTGAGGTC
Tremella mesenterica DSM 1558 hypothetical protein (TREMEDRAFT_41300), mRNA
XM_007008209.1:1032-1046
CGTGACGAAGAGGGTCAGGATGTGTTGCTC1032TTCATTGACAACATTTTCCGATTCACCCAGGCCGGTTCCGAGGTG
PREDICTED: Physeter catodon dynein, axonemal, heavy chain 5 (DNAH5), mRNA
XM_007127169.1:6420-6434
ATCATCAGGGTGAAGTTGGCTAGTTGCGGC6420TTCATTGACAACATTGTTTTGGCCAGGAAGTTTTTCACGCTCTAC
PREDICTED: Balaenoptera acutorostrata scammoni dynein, axonemal, heavy chain 5 (DNAH5), mRNA
XM_007188253.1:6387-6401
ATCATCAGGGTGAAGTTGGCTAGTTGCGGC6387TTCATTGACAACATTGTTTTGGCCAGGAAGTTTTTCACGCTCTAC
Colletotrichum gloeosporioides Nara gc5 ATP synthase beta (CGGC5_13870), partial mRNA
XM_007286033.1:871-885
CGTGACGAGGAGGGACAGGATGTGTTGCTT871TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCTGAGGTG
Agaricus bisporus var. burnettii JB137-S8 ATP2 beta subunit of the F1 sector of mitochondrial F1F0 ATP synthase (AGABI1DRAFT_111188), mRNA
XM_007326499.1:1000-1014
CGTGATGAAGAAGGTCAGGATGTGTTGCTC1000TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCCGAGGTG
Melampsora larici-populina 98AG31 hypothetical protein (MELLADRAFT_45062), mRNA
XM_007415010.1:1070-1084
CGTGACGAAGAGGGACAAGATGTGCTTTTG1070TTCATTGACAACATTTTCCGATTCACCCAAGCTGGTTCCGAGGTA
Neofusicoccum parvum UCRNP2 putative -alpha-glucan-branching enzyme protein mRNA
XM_007581450.1:2986-3000
CGTGATGAGGAGGGCCAGGATGTGCTTCTC2986TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCCGAGGTG
Coniophora puteana RWD-64-598 SS2 ATP synthase F1 beta subunit mRNA
XM_007766058.1:968-982
CGTGACGAGGAGGGCCAGGACGTGCTTCTG968TTCATTGACAACATTTTCCGCTTCACGCAAGCCGGTTCCGAGGTA
Coniophora puteana RWD-64-598 SS2 hypothetical protein partial mRNA
XM_007775178.1:2305-2319
ATGAACGAAGTCAAAGAGTCGGCTCAAAGC2305TTCATTGACAACATTCAGAGGAGAACGGTCTTTGTTTCCCAAAAC
Endocarpon pusillum Z07020 ATP synthase subunit beta mRNA
XM_007802133.1:979-993
CGTGACGAGGAAGGACAGGACGTGCTGCTC979TTCATTGACAACATTTTCCGATTCACCCAGGCTGGTTCTGAGGTG
Eutypa lata UCREL1 putative atp synthase beta mitochondrial precursor protein mRNA
XM_007795522.1:856-870
CGTGACGAGGAAGGCCAGGATGTGCTTCTC856TTCATTGACAACATTTTCCGTTTCACTCAAGCCGGTTCTGAGGTG
Metarhizium acridum CQMa 102 ATP synthase beta chain precursor partial mRNA
XM_007816203.1:1081-1095
CGTGACCAGGAAGGCCAGGATGTGCTGCTC1081TTCATTGACAACATTTTCCGATTCACTCAGGCCGGCTCTGAGGTG
Pestalotiopsis fici W106-1 ATP synthase subunit beta mRNA
XM_007837839.1:871-885
CGTGACGCCGAGGGACAGGATGTGCTGCTC871TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCCGAGGTG
PREDICTED: Eptesicus fuscus dynein, axonemal, heavy chain 5 (DNAH5), mRNA
XM_008151678.1:6367-6381
ATCATAAGAGTGAAGCTGGCTAGCTGTGGC6367TTCATTGACAACATTGTGTTGGCCAGGAAGTTTTTCACGCTCTAC
PREDICTED: Stegastes partitus homeobox protein engrailed-1-like (LOC103355596), transcript variant X1, mRNA
XM_008279450.1:396-410
GCTCAGCAGGCCCACAGAACCACCAACTTT396TTCATTGACAACATTTTGCGACCGGACTTCGGCTGTAAAAAGGAG
PREDICTED: Stegastes partitus homeobox protein engrailed-1-like (LOC103355596), transcript variant X2, mRNA
XM_008279451.1:396-410
GCTCAGCAGGCCCACAGAACCACCAACTTT396TTCATTGACAACATTTTGCGACCGGACTTCGGCTGTAAAAAGGAG
PREDICTED: Equus przewalskii activating signal cointegrator 1 complex subunit 1 (ASCC1), transcript variant X1, mRNA
XM_008539341.1:744-758
TGTGAGATGCTACAGCAGTGTAAAGAGGAA744TTCATTGACAACATTTGTGGGGGCAAACCCCTGGAAGTAGAGATG
PREDICTED: Equus przewalskii activating signal cointegrator 1 complex subunit 1 (ASCC1), transcript variant X2, mRNA
XM_008539342.1:742-756
TGTGAGATGCTACAGCAGTGTAAAGAGGAA742TTCATTGACAACATTTGTGGGGGCAAACCCCTGGAAGTAGAGATG
PREDICTED: Ursus maritimus dynein, axonemal, heavy chain 5 (DNAH5), transcript variant X1, mRNA
XM_008689897.1:6457-6471
ATCATAAGGGTGAAGCTGGCTAGTTGTGGC6457TTCATTGACAACATTGTGTTGGCCAGGAAGTTTTTCACACTCTAC
PREDICTED: Ursus maritimus dynein, axonemal, heavy chain 5 (DNAH5), transcript variant X2, mRNA
XM_008689898.1:6451-6465
ATCATAAGGGTGAAGCTGGCTAGTTGTGGC6451TTCATTGACAACATTGTGTTGGCCAGGAAGTTTTTCACACTCTAC
Cyphellophora europaea CBS 101466 ATP synthase subunit beta, mitochondrial partial mRNA
XM_008715668.1:1486-1500
AGAGACGAAGAAGGTCAAGATGTGTTGCTC1486TTCATTGACAACATTTTCCGCTTCACTCAGGCCGGTTCTGAAGTG
Capsella rubella hypothetical protein (CARUB_v10007625mg) mRNA, complete cds
XM_006282891.1:997-1011
CGTGATGCTGAAGGCCAAGATGTCTTGCTT997TTCATTGACAACATTTTCCGTTTCACTCAGGCCAACTCTGAAGTG
Capsella rubella hypothetical protein (CARUB_v10000603mg) mRNA, complete cds
XM_006287335.1:1122-1136
CGTGATGCCGAAGGCCAAGATGTCTTGCTT1122TTCATTGACAACATTTTCCGTTTCACTCAGGCTAACTCTGAAGTG
Capsella rubella hypothetical protein (CARUB_v10000474mg) mRNA, complete cds
XM_006287217.1:1186-1200
CGTGATGCGGAAGGCCAAGATGTCTTGCTT1186TTCATTGACAACATTTTCCGATTTACTCAGGCCAACTCTGAAGTG
Wallemia ichthyophaga EXF-994 hypothetical protein partial mRNA
XM_009268544.1:907-921
CGTGACGATGAAGGTCAAGATGTCTTGCTC907TTCATTGACAACATTTTCCGTTTCACTCAAGCTGGTTCTGAAGTT
Heterobasidion irregulare TC 32-1 beta subunit of putative F0F1-type ATP synthase mRNA
XM_009544597.1:984-998
CGTGATGAGGAAGGTCAGGATGTGTTGCTC984TTCATTGACAACATTTTCCGCTTCACTCAGGCCGGTTCCGAGGTG
PREDICTED: Cariama cristata ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide (ATP5B), partial mRNA
XM_009697087.1:619-633
AGGGACCAGGAGGGTCAGGACGTGCTGCTC619TTCATTGACAACATTTTCCGCTTCACCCAGGCTGGCTCAGAGGTG
Neurospora tetrasperma FGSC 2508 H+-transporting ATP synthase beta chain mRNA
XM_009854061.1:982-996
CGTGATGAGGAGGGTCAGGATGTGTTGCTC982TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCTGAGGTG
Nicotiana sylvestris ATP synthase subunit beta, mitochondrial-like (LOC104229400), mRNA
NM_001302565.1:993-1007
AGAGATGCTGAGGGGCAGGATGTGCTTCTC993TTCATTGACAACATTTTCAGATTTACCCAGGCTAACTCAGAGGTG
Colletotrichum fioriniae PJ7 ATP synthase F1 mRNA
XM_007596617.1:868-882
CGTGACGAGGAGGGACAGGATGTGTTGCTC868TTCATTGACAACATTTTCCGTTTCACCCAGGCCGGTTCCGAGGTG
Moniliophthora roreri MCA 2997 atp synthase subunit beta partial mRNA
XM_007857359.1:943-957
CGTGATGAGGAGGGTCAGGATGTGTTGCTC943TTCATTGACAACATTTTCCGATTCACCCAAGCCGGCTCCGAAGTG
PREDICTED: Elaeis guineensis ATP synthase subunit beta, mitochondrial-like (LOC105041149), mRNA
XM_010917990.1:1137-1151
CGAGATGCTGAAGGGCAAGATGTGCTTCTT1137TTCATTGACAACATTTTCCGTTTCACCCAAGCAAATTCTGAAGTG
PREDICTED: Populus euphratica ATP synthase subunit beta, mitochondrial-like (LOC105124531), mRNA
XM_011024585.1:1120-1134
CGTGATGCTGAAGGGCAAGATGTGCTTCTC1120TTCATTGACAACATTTTCCGCTTTACCCAGGCTAACTCAGAGGTG
PREDICTED: Populus euphratica uncharacterized LOC105127860 (LOC105127860), mRNA
XM_011029320.1:5024-5038
CTCCCAGTTTGTGAACCATTATCTAGACGA5024TTCATTGACAACATTGAGAAGCCAAAAGTTCAGCAGCTAATCAGT
PREDICTED: Populus euphratica ATP synthase subunit beta, mitochondrial (LOC105135509), mRNA
XM_011040401.1:1087-1101
CGTGATGCTGAAGGGCAAGATGTGCTTCTA1087TTCATTGACAACATTTTCCGCTTTACCCAGGCTAACTCAGAGGTG
PREDICTED: Populus euphratica ATP synthase subunit beta, mitochondrial-like (LOC105119519), mRNA
XM_011017661.1:1124-1138
CGTGATGCTGAAGGGCAAGATGTGCTTCTC1124TTCATTGACAACATTTTCCGCTTTACCCAGGCTAACTCAGAGGTG
PREDICTED: Solenopsis invicta prefoldin subunit 1 (LOC105204559), transcript variant X1, mRNA
XM_011173678.1:229-243
GAAATTCAAGGGTAATTTTTTGTAAGTTTA229TTCATTGACAACATTGTGATAATCAAGGATGTCAAAAGTACTAGA
PREDICTED: Bactrocera cucurbitae ATP synthase subunit beta, mitochondrial (LOC105219929), mRNA
XM_011196280.1:889-903
CGTGATCAGGAGGGACAAGATGTACTGCTT889TTCATTGACAACATTTTCCGCTTCACCCAAGCTGGTTCAGAAGTG
PREDICTED: Bactrocera cucurbitae ATP synthase subunit beta, mitochondrial-like (LOC105220561), partial mRNA
XM_011197006.1:905-919
CGTGATCAGGAGGGACAAGATGTACTGCTT905TTCATTGACAACATTTTCCGCTTCACCCAAGCTGGTTCAGAAGTG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/refseq80/TTCATTGACAACATT
lang : en | db : refseq80 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.173 | 0.166 | search_plus_done; http://172.18.8.74:28690/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.211 | 0.037 | search_minus_done; http://172.18.8.74:28690/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=0
0.211 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).