GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2024-04-25 06:54:15, GGGenome : Rhesus genome, Mmul_10/rheMac10, D3G 23.02 (Feb, 2023)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr2
position: 113358661-113358675
GCCTGTTTTTCATATGCATATGTAATAGGG113358661AATGTTGTCAATGAAAACACAATAGTATTTGGAGTGCAGCATAGT
chr11
position: 78709330-78709344
GTAAGATAGGTTTGTTCCAGAAGTTTAAAA78709330AATGTTGTCAATGAATTTGATAAAATTTAATATTCACATTAGAAG
chr14
position: 41003831-41003845
GTTTGCTCTATTCACTGTCCTCAACGCTAG41003831AATGTTGTCAATGAACAAGACATATCTATGTTCCTGGAAACTCAA
chr19
position: 40093681-40093695
ACTCCCTTAGGAGAGCTGTAACATTATACT40093681AATGTTGTCAATGAAAAGCTAAGACAGGCCAGGGGTGGTGGCTCA
chr19
position: 40144780-40144794
CTCCCTTAGGAGAGCCGTTAACATTATACT40144780AATGTTGTCAATGAAAAAGCTAAGATAGGCAGGGCGTGGTGGCTC
chr5
position: 146527341-146527355
CAGAATATATTATCGCTTTGAACACAGATT146527341TTCATTGACAACATTTTGTGGGCATCCATTTAATATTAATATTAA
chr5
position: 163209068-163209082
TAAAACCTCTGATTTTGTGTAACACTCCTT163209068TTCATTGACAACATTAAACAGCAATTAACTATTTGCTGACTACAT
chr5
position: 178769009-178769023
TTTGGACCCCCAGATCAGTCTTCATATTCT178769009TTCATTGACAACATTCATGAAGTTCTGCAGAAATTAGATAGAATT
chr5
position: 183557954-183557968
GCCTGAGCCACCATGCCCAGCTTGCTATTC183557954TTCATTGACAACATTCACTTAAACAAACAAACATCCATAAAATTA
chr16
position: 13890825-13890839
GCCTCTGGGCCTATATTAGATGGGCCATGC13890825TTCATTGACAACATTGATTTTATGTTTATTTGTGAAAGGGCAGAA
chr17
position: 49200745-49200759
TGTTCAAAGTTTTCCCCTCCAATGTATCTT49200745TTCATTGACAACATTCGGATTTATCACATCAATCAGTCAATAAAT
chr17
position: 66037760-66037774
GCAGTCTGGAGGTTCTCCCTGGAGGCTGTA66037760TTCATTGACAACATTGCCTGAGGTAACTCACACTGAGGTGACAAC
chr19_NW_021160375v1_random
position: 158477-158491
GTGAGCCACCACGCCGGCCTATCTTAGCTT158477TTCATTGACAACATTAGTATAATGTTAACAGCTCTCCTGGCAATG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/rheMac10_d3g2302/AATGTTGTCAATGAA
lang : en | db : rheMac10_d3g2302 | k : 0 | strand : | nogap : | query_string : AATGTTGTCAATGAA | format : html | download : | debug :

0.009 | 0.009 | search_start;
0.082 | 0.073 | search_plus_done; http://172.18.8.78:28953/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=50
0.090 | 0.008 | search_minus_done; http://172.18.8.78:28953/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=45
0.095 | 0.006 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).