GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2020-12-01 11:26:15, GGGenome : Rat genome, RGSC 6.0/rn6 (Jul, 2014)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr2:41926733-41926747
TTTTCAAAATCTTTTGCCTGTATAGACTTT41926733TTCATTGACAACATTAAACTGTATGACATGCAAAAAATAACAGGT
chr2:57234252-57234266
CCTCTCCCATTTACATTTAGTTTTAAGTAA57234252TTCATTGACAACATTTTTTGCATTGTTCAGCCCTTTACCTGTATT
chr2:60329867-60329881
CTGAACTTTCACCATAACAACCCATTAGGT60329867TTCATTGACAACATTCTATGGCAGCTATAGACCCCAACTCCAAAT
chr2:91373041-91373055
TGAATGAAAGGTCAGAGTTCAAGGTGTGAT91373041TTCATTGACAACATTAAATATTTACTGAATCTTAAATCTTATCCT
chr4:160096536-160096550
AAACTGCGCTAAGCAAGACGGTATGGTATT160096536TTCATTGACAACATTAAAGAAAATAGAGAGATAGACACTCGTGTG
chr14:32365434-32365448
GAAGCTAATAGTGCAATCGCCATGGTCTCC32365434TTCATTGACAACATTAACAGCTGTAATAAAATCAAGATATTGGCA
chr18:24697076-24697090
ACATTCCTTACTCCTCTGACAGCAGTTTCT24697076TTCATTGACAACATTCAGGCTATCAGGCCTGATGTTGAGGTCCTT
chr2:239732088-239732102
ATACCAAGTAAAAAAACAAAAAAACAAAAA239732088AATGTTGTCAATGAAGGTGTGGAAGAAAATTTTCCAAACCTAGTG
chr3:31282717-31282731
CTACTTATTCATTCATGTATGTGGGTTTCA31282717AATGTTGTCAATGAACACTGCTGCTTCATCGAACACATGAAAAAT
chr5:97952035-97952049
CATTGTCAACAGTTATACATTTGAAACTTT97952035AATGTTGTCAATGAAATAGATCTGTTCATCAAATAATCTGAAAAA
chr5:98026329-98026343
CATTGTCAACAGTTATACATTTGAAACTTT98026329AATGTTGTCAATGAAATAGATCTGTTCATCAAATAATCTGAAAAA
chr6:69203225-69203239
CCATAGATTAGTCATAGATAGCAGCTACTA69203225AATGTTGTCAATGAAGTTTCTACACAAATGGTAATTAGGCAATTT
chr7:112621412-112621426
TCTCTTATGTATCCATTGTCCAATTTCTAG112621412AATGTTGTCAATGAACTGTGTCTTTGAGGCAGTTTCTTTTTGAGC
chr11:80854350-80854364
TTATTCTCTTTAAAATTCACCACAAGGAAA80854350AATGTTGTCAATGAAAATTTAACAATAAGAAAAGAAGGTAAAAAC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/rn6/TTCATTGACAACATT
lang : en | db : rn6 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.078 | 0.071 | search_plus_done; http://172.18.8.77:28054/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.083 | 0.005 | search_minus_done; http://172.18.8.77:28054/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=43
0.084 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).