GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2025-10-30 05:33:40, GGGenome : Rat pre-spliced RNA, RefSeq curated on mRatBN7.2/rn7, D3G 22.02 (Feb, 2022)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

NM_053952.1|Nup155;117021|chr2:57201309:57252918:+|prespliced::chr2:57201309-57252918(+)
position: 27620-27634
CCTCTCCCATTTACATTTAGTTTTAAGTAA27620TTCATTGACAACATTTTTTGCATTGTTCAGCCCTTTACCTGTATT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : https://gggenome.dbcls.jp/rn7_RefSeqCurated_prespliced_d3g2202/AATGTTGTCAATGAA
lang : en | db : rn7_RefSeqCurated_prespliced_d3g2202 | k : 0 | strand : | nogap : | query_string : AATGTTGTCAATGAA | format : html | download : | debug :

0.009 | 0.009 | search_start;
0.083 | 0.074 | search_plus_done; http://172.18.8.78:28917/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=50
0.087 | 0.004 | search_minus_done; http://172.18.8.78:28917/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.088 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).