GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2022-07-06 07:04:03, GGGenome : Rat genome, mRatBN7.2/rn7 (Nov, 2020)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr2
position: 41984772-41984786
TTTTCAAAATCTTTTGCCTGTATAGACTTT41984772TTCATTGACAACATTAAACTGTATGACATGCAAAAAATAACAGGT
chr2
position: 57228929-57228943
CCTCTCCCATTTACATTTAGTTTTAAGTAA57228929TTCATTGACAACATTTTTTGCATTGTTCAGCCCTTTACCTGTATT
chr2
position: 59328893-59328907
CTGAACTTTCACCATAACAACCCATTAGGT59328893TTCATTGACAACATTCTATGGCAGCTATAGACCCCAACTCCAAAT
chr4
position: 160381290-160381304
AAACTGCGCTAAGCAAGACGGTATGGTATT160381290TTCATTGACAACATTAAAGAAAATAGAGAGATAGACACTCGTGTG
chr14
position: 30092986-30093000
GAAGCTAATAGTGCAATCGCCATGGTCTCC30092986TTCATTGACAACATTAACAGCTGTAATAAAATCAAGATATTGGCA
chr18
position: 23542900-23542914
ACATTCCTTACTCCTCTGACAGCAGTTTCT23542900TTCATTGACAACATTCAGGCTATCAGGCCTGATGTTGAGGTCCTT
chr2
position: 4519536-4519550
AGGATAAGATTTAAGATTCAGTAAATATTT4519536AATGTTGTCAATGAAATCACACCTTGAACTCTGACCTTTCATTCA
chr2
position: 222985943-222985957
ATACCAAGTAAAAAAACAAAAAAACAAAAA222985943AATGTTGTCAATGAAGGTGTGGAAGAAAATTTTCCAAACCTAGTG
chr3
position: 31606500-31606514
CTACTTATTCATTCATGTATGTGGGTTTCA31606500AATGTTGTCAATGAACACTGCTGCTTCATCGAACACATGAAAAAT
chr5
position: 94935913-94935927
CATTGTCAACAGTTATACATTTGAAACTTT94935913AATGTTGTCAATGAAATAGATCTGTTCATCAAATAATCTGAAAAA
chr6
position: 65952859-65952873
CCATAGATTAGTCATAGATAGCAGCTACTA65952859AATGTTGTCAATGAAGTTTCTACACAAATGGTAATTAGGCAATTT
chr7
position: 103337592-103337606
TCTCTTATGTATCCATTGTCCAATTTCTAG103337592AATGTTGTCAATGAACTGTGTCTTTGAGGCAGTTTCTTTTTGAGC
chr11
position: 77453753-77453767
TTATTCTCTTTAAAATTACACCAAAAGGAA77453753AATGTTGTCAATGAAAATTTAACAATAAGAAAAGAAGGTTAAAAA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/rn7_d3g2202/TTCATTGACAACATT
lang : en | db : rn7_d3g2202 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.090 | 0.082 | search_plus_done; http://172.18.8.78:28921/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.103 | 0.012 | search_minus_done; http://172.18.8.78:28921/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=44
0.107 | 0.004 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).