GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2022-12-06 10:48:34, GGGenome : S. purpuratus genome, Baylor 2.1/strPur2 (Sep, 2006)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Scaffold8129:25148-25162
CATATCAAGGTTATTATTAAAAAGCCTCTT25148TTCATTGACAACATTTGAAAAGAAAAGAAAAATCCAAAAACCTCT
Scaffold77728:3706-3720
CGAGGTATGGTTGAGTTTTGACTTGTGATT3706TTCATTGACAACATTGACTCTACGACCTTAAACATTGGGAATACA
Scaffold58787:40846-40860
TTTGTAATTGTTCATATCTTATATCTCACT40846TTCATTGACAACATTCTATAAAACCTCAATGTTCAAACACAATAA
Scaffold71379:10480-10494
AGTTTTATTTTGACATAGTGTTCATTACGC10480TTCATTGACAACATTGACATGACTACAGCATCCTTAACACACGTG
Scaffold870:78825-78839
ATTTTTGCCTGAACCGAGCAGGATTGTGCT78825TTCATTGACAACATTATAGAAAGTGTGATAAAAGATGCATCCTTT
Scaffold18968:76800-76814
TAATACATTCTTGGCTCACAGATGTCCCTT76800TTCATTGACAACATTGTTGTTAATGTTCCGATAGGAAGCTATGTT
Scaffold114105:190-204
AGTTTTATTTTGACATAGTGTCCATTACGC190TTCATTGACAACATTGACACGACTACAGCATCCTTAACCCTATTT
Scaffold47463:46315-46329
TCAATAGTGAGAAACTGTCGAAAACTCTAA46315AATGTTGTCAATGAAGATAATAGAAATATGAATGCATGTTGTGGA
Scaffold59617:4913-4927
CGGGTTGTCTGCTCGTTCAAATTTTACACA4913AATGTTGTCAATGAACAGTGAACATGCACAGCAGGGCCTTGGAAG
Scaffold72751:7571-7585
ATATCGTCAATTTTTCGTGTCCTGGACTTG7571AATGTTGTCAATGAAAAATTCCCTATAAACAGGTTTCCCATTTTT
Scaffold64477:39617-39631
TACAAGACTAGTGGTAGTACATTGGACACC39617AATGTTGTCAATGAATTCAGAGTGGGAAGCAAGCAGTGTATCAGT
Scaffold4301:65184-65198
AGACCTACTGCGTTTGTCATCGATGAAAAA65184AATGTTGTCAATGAAAACATGAAATGAAGTGAAGTAATCTTACCT
Scaffold29777:166913-166927
CATGTGTGTTAAGGATGCCGTAGTCAAGTC166913AATGTTGTCAATGAAGCGTAATGGACACTATGTCAATATAAAACT

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/strPur2/TTCATTGACAACATT
lang : en | db : strPur2 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.082 | 0.074 | search_plus_done; http://172.18.8.76:28092/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.087 | 0.005 | search_minus_done; http://172.18.8.76:28092/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=43
0.089 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).