GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-12-01 11:56:56, GGGenome : Zebra finch genome, WashU taeGut324/taeGut2 (Feb, 2013)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

chr1A:33074283-33074297
TTCTGCAGTGAAGCTTATTCTGTTAAGTGT33074283TTCATTGACAACATTTGAACTAGCTAAAACAACAGCATGACCCCC
chr1A:36483701-36483715
AAACAGAACTGAAGGATTAAACCTTTGTTG36483701TTCATTGACAACATTTGTTTCTGGGTTGTCAGGTGTTCACATTGG
chr2:76030210-76030224
TCATAGGCTATGGCTAATAGGACTCCCTGA76030210TTCATTGACAACATTAATATTCCAGTGTCCTGAAATATAGAAGAT
chr1A:31591557-31591571
CTTTCCCAAGACATAAAATTGATTGAAAAA31591557AATGTTGTCAATGAAAATTAGAATATCTTCCAGCCCAAATCAAAA
chr2:100829052-100829066
GAATGTGGGCATATCCACGAAGCATTTCAA100829052AATGTTGTCAATGAAGAGAGAACAGCTCACACTATAAAATGAATT
chr3:95591523-95591537
TAGCAGACTTGTGACCTTTATGTATCTACA95591523AATGTTGTCAATGAAACGGCTCCTGAAGACAATTAAATGACAACA
chr4A_EQ832705_random:37928-37942
TAAAAAAAAATAATTCTTAAGCAAAATTTA37928AATGTTGTCAATGAAAACTGAAGCCAGTGAAATACCTCTCTGTAG
chrZ:11224809-11224823
CATTTGTAAAAGCAAGAACTGCCTGATAGA11224809AATGTTGTCAATGAACTGTAAAGCAAGTCCTTCATCAGCAGTGAG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/taeGut2/TTCATTGACAACATT
lang : en | db : taeGut2 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.086 | 0.079 | search_plus_done; http://172.18.8.76:28086/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.090 | 0.004 | search_minus_done; http://172.18.8.76:28086/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=47
0.091 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).