GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2022-12-06 10:05:34, GGGenome : Tarsier genome, Tarsius_syrichta-2.0.1/tarSyr2 (Sep, 2013)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

KE938214v1:331272-331286
AAGATTTCCTTCATTGTAAAAAGTACACAT331272TTCATTGACAACATTTTAAAACATGTGTTACCCAGTGTTTACCAA
KE938434v1:179965-179979
CTCCCTATCTTTTATTCCCTAGTCCATTGT179965TTCATTGACAACATTCTTGACTGTCTCCCTCCTTTGTCTATCGTA
KE941073v1:830781-830795
ATGACATAAGCATTGTTGGATTTGTTTAAG830781TTCATTGACAACATTCCCGTCTTTGCCTTTTAAGTTCTGAACCAA
KE943607v1:190565-190579
CTGGGATTCAGGCTCTATAATGCATATTGT190565TTCATTGACAACATTCAAAACTTCATAGGCAGTGAATTAAAAAAT
KE946568v1:293871-293885
TGTACAAGGGCTTGGATATCACAAGGCACA293871TTCATTGACAACATTAATGTAACAATGCAGCACACTATAAAGTTA
KE949125v1:186577-186591
CCAGTATACTGCACTCCAAATACTATTGTT186577TTCATTGACAACATTCACTATTACATATGCATATGAAAAACAGGC
KE949725v1:9387-9401
TTTGGCCTTTTGACAATTAGTCAATTATTC9387TTCATTGACAACATTTTGACCTCATTACCCAGTAGTTATTAAACT
KE938866v1:16975-16989
GCAGAAATAATTTGGAGGTCTCAAGTTTCA16975AATGTTGTCAATGAATCAGTTCACAATTGAAGACTGTAAGCCATC
KE939692v1:152373-152387
ACATCACTGTGTATTCCGTGAATAGGCACA152373AATGTTGTCAATGAAGTTTTTATAATTTTAAAAAGTATAAGTACA
KE940006v1:68111-68125
GTACATTTTCTGCTAAAGCCATACCTGGTT68111AATGTTGTCAATGAATATAACCGAAGGTATAGACCAATGTTTGAT
KE941432v1:1146956-1146970
CAAGAGATTCATAGCAGAAACCTTGTGTCA1146956AATGTTGTCAATGAAGGTTTTTTGAAGGGATGGGTTAACACTACA
KE944433v1:53767-53781
ATAGTAGCTGTAACATAACAAGCATTGGGT53767AATGTTGTCAATGAATAAATAGATGAATAATGTATCTTCCTGTTA
KE948815v1:493612-493626
ATGCAAGATGGCTTGAATGAATTTGTATCC493612AATGTTGTCAATGAAAGGAAGGTGAGGAGGGAAGGAGAACCCTCT
KE948841v1:529362-529376
CCCATAATCAAACACATAATCAAACACATT529362AATGTTGTCAATGAAACTTATGAATATTCACACTAATTAAGATAA
KE950583v1:865893-865907
TTGTCACCTTCAGCGTGAGTTACCTCAGGC865893AATGTTGTCAATGAATACAGCCTCCAGGGAGAACCTCTAGTCACA

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/tarSyr2/TTCATTGACAACATT
lang : en | db : tarSyr2 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.087 | 0.079 | search_plus_done; http://172.18.8.77:28773/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.099 | 0.013 | search_minus_done; http://172.18.8.77:28773/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=43
0.101 | 0.002 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).