GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2024-05-26 14:04:01, GGGenome : TogoGenome from RefSeq 211 (Mar, 2022)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

Peromyscus leucopus breed LL Stock chromosome 1, UCI_PerLeu_2.1, whole genome shotgun sequence.
taxonomy:"10041", bioproject:"PRJNA533285", refseq:"NC_051063.1"
NC_051063.1:29351465-29351479
ATATGCTAGAAATGTAAATCCTCAAACTCA29351465TTCATTGACAACATTTGGACATGGGGGATTCAGGCTAACTGGGAC
Peromyscus leucopus breed LL Stock chromosome 2, UCI_PerLeu_2.1, whole genome shotgun sequence.
taxonomy:"10041", bioproject:"PRJNA533285", refseq:"NC_051064.1"
NC_051064.1:76180315-76180329
TGTTAATCAGCCCTATACTTTTAGAAGATA76180315TTCATTGACAACATTTTCCTATAACTCTATCATAAAAAATCTATA
Peromyscus leucopus breed LL Stock chromosome 5, UCI_PerLeu_2.1, whole genome shotgun sequence.
taxonomy:"10041", bioproject:"PRJNA533285", refseq:"NC_051067.1"
NC_051067.1:74059056-74059070
ACACTCATGATATTAATTACATTTGTGGTA74059056TTCATTGACAACATTCGCAGTACTCATTCAATAATTATATTTATG
Peromyscus leucopus breed LL Stock chromosome 7, UCI_PerLeu_2.1, whole genome shotgun sequence.
taxonomy:"10041", bioproject:"PRJNA533285", refseq:"NC_051069.1"
NC_051069.1:10429016-10429030
GGCAATGTGCTGGACATCAAATGGAACCCC10429016TTCATTGACAACATTATCGCCTCGTGCTCCGAGGACACTTCGGTG
Peromyscus leucopus breed LL Stock chromosome 11, UCI_PerLeu_2.1, whole genome shotgun sequence.
taxonomy:"10041", bioproject:"PRJNA533285", refseq:"NC_051072.1"
NC_051072.1:5449199-5449213
TTGTCCTGGAAGTGCTGTGTGTACTTTAAT5449199TTCATTGACAACATTCAAGTGATTCTGGGTCCTTTCCACAGATGA
Peromyscus leucopus breed LL Stock chromosome 11, UCI_PerLeu_2.1, whole genome shotgun sequence.
taxonomy:"10041", bioproject:"PRJNA533285", refseq:"NC_051072.1"
NC_051072.1:10034362-10034376
AAACTATTGCACTTAGATTTGACTTAGTAT10034362TTCATTGACAACATTTATTTTTGAAAGAATATGAGAAACAATTTT
Peromyscus leucopus breed LL Stock chromosome 16_21, UCI_PerLeu_2.1, whole genome shotgun sequence.
taxonomy:"10041", bioproject:"PRJNA533285", refseq:"NC_051084.1"
NC_051084.1:22664463-22664477
TTTCAGGAGTACTAGATTGCTAGCTTATAT22664463TTCATTGACAACATTTTTATCTGAAGCCATCATTGTCTAGAGAAG
Mus caroli chromosome 14, CAROLI_EIJ_v1.1, whole genome shotgun sequence.
taxonomy:"10089", bioproject:"PRJNA387030", refseq:"NC_034583.1"
NC_034583.1:98974699-98974713
TGCTGCTGCAGTCACTCCCTGGAGGTTGTG98974699TTCATTGACAACATTGCCCAAGGTGCCTTCCACTGAGAGTGACAA
Mus caroli chromosome 18, CAROLI_EIJ_v1.1, whole genome shotgun sequence.
taxonomy:"10089", bioproject:"PRJNA387030", refseq:"NC_034587.1"
NC_034587.1:568199-568213
TTCCTCAAACTCTAAAAAGTCTTTAATTTC568199TTCATTGACAACATTTTCATTGAGGAGAGTGTTGTTCAGCTTCCA
Mus musculus strain C57BL/6J chromosome 2, GRCm39.
taxonomy:"10090", bioproject:"PRJNA169", refseq:"NC_000068.8"
NC_000068.8:131322033-131322047
AGACAAATTAAGACTGTATTGTATCATGGT131322033TTCATTGACAACATTTAAAATTGTTACATATTTCAAAATTTTTTA
Mus musculus strain C57BL/6J chromosome 5, GRCm39.
taxonomy:"10090", bioproject:"PRJNA169", refseq:"NC_000071.7"
NC_000071.7:42475572-42475586
TAGAATCAGTGTAAGCCATCCCTACACTTA42475572TTCATTGACAACATTCATGCAATCTTCAGTGTTCATTACTTTGCT
Mus musculus strain C57BL/6J chromosome 6, GRCm39.
taxonomy:"10090", bioproject:"PRJNA169", refseq:"NC_000072.7"
NC_000072.7:141367254-141367268
AAAGTACTATCAGTTTCCTAAATATATCCA141367254TTCATTGACAACATTGTTCACTCTTCCATAAACATCTGCTGGTTA
Mus musculus strain C57BL/6J chromosome 6, GRCm39.
taxonomy:"10090", bioproject:"PRJNA169", refseq:"NC_000072.7"
NC_000072.7:146076574-146076588
TGAACACATTCTCCCTGTTTGTGTCATCAC146076574TTCATTGACAACATTTAACTGGGCCTTCTGTGTGGATACCATGAT
Mus musculus strain C57BL/6J chromosome 10, GRCm39.
taxonomy:"10090", bioproject:"PRJNA169", refseq:"NC_000076.7"
NC_000076.7:46938994-46939008
TATTTCTTTCTGTTTGTTTATATGATGGAC46938994TTCATTGACAACATTTCATATATGTAACCATCCTGTATCTCTGTA
Mus musculus strain C57BL/6J chromosome 14, GRCm39.
taxonomy:"10090", bioproject:"PRJNA169", refseq:"NC_000080.7"
NC_000080.7:109479096-109479110
TGCTGCTGGAATCTCTCCCTGGAGGGTGTG109479096TTCATTGACAACATTGCCCACTGAGAGTGACAACCTCAGCAGCCA
Mus pahari chromosome 2, PAHARI_EIJ_v1.1, whole genome shotgun sequence.
taxonomy:"10093", bioproject:"PRJNA387191", refseq:"NC_034591.1"
NC_034591.1:156183567-156183581
AGAGTACTATTAGTTTCCTAAATATACCCA156183567TTCATTGACAACATTGTTCACTCTTCCATAAGCACCTGCTGTTAT
Mus pahari chromosome 2, PAHARI_EIJ_v1.1, whole genome shotgun sequence.
taxonomy:"10093", bioproject:"PRJNA387191", refseq:"NC_034591.1"
NC_034591.1:160645130-160645144
CGAACACACTCTCCCTGTTCGTGTCATCAC160645130TTCATTGACAACATTTAACCAGGCCTTCTCTGTGGCCTCATGATA
Mus pahari chromosome 4, PAHARI_EIJ_v1.1, whole genome shotgun sequence.
taxonomy:"10093", bioproject:"PRJNA387191", refseq:"NC_034593.1"
NC_034593.1:137821595-137821609
TCTTTATTTGTTGACATTTCTATTTTGTCT137821595TTCATTGACAACATTGCAATCAAATATTCATTCCTTCACTCAATG
Mus pahari chromosome 10, PAHARI_EIJ_v1.1, whole genome shotgun sequence.
taxonomy:"10093", bioproject:"PRJNA387191", refseq:"NC_034599.1"
NC_034599.1:34125822-34125836
CTACATCCCAACATTAATATCTTATTTGAA34125822TTCATTGACAACATTTATAATTTCTGTTTCAAGTTGTCATTTACA
Mus pahari chromosome 14, PAHARI_EIJ_v1.1, whole genome shotgun sequence.
taxonomy:"10093", bioproject:"PRJNA387191", refseq:"NC_034603.1"
NC_034603.1:8720060-8720074
TAGGAAAAACAAAGGGATTGGGTGCACACC8720060TTCATTGACAACATTCACTGCCTTCAGGTGGACTTTCTGTACATG
Mus pahari chromosome 16, PAHARI_EIJ_v1.1, whole genome shotgun sequence.
taxonomy:"10093", bioproject:"PRJNA387191", refseq:"NC_034605.1"
NC_034605.1:8915162-8915176
CTGGGGAGGTAGAGATGGAAAAATCAGAAG8915162TTCATTGACAACATTGGTTATATTGTAAGTTCAAAGCCAGCCTGA
Mus pahari chromosome 17, PAHARI_EIJ_v1.1, whole genome shotgun sequence.
taxonomy:"10093", bioproject:"PRJNA387191", refseq:"NC_034606.1"
NC_034606.1:35452727-35452741
AAATGTTTCTATGTAAAAGTTAGTCTTATT35452727TTCATTGACAACATTGATGTCTAAATTTCACATGTCTCCTTATAT
Mus pahari chromosome 19, PAHARI_EIJ_v1.1, whole genome shotgun sequence.
taxonomy:"10093", bioproject:"PRJNA387191", refseq:"NC_034608.1"
NC_034608.1:38918721-38918735
ACTGAAACTGAAAAAAGAAAGAAGGGAGTT38918721TTCATTGACAACATTTCTTCTCATTTTTAGCTTCTGAAATGGGGG
Mus pahari chromosome 22, PAHARI_EIJ_v1.1, whole genome shotgun sequence.
taxonomy:"10093", bioproject:"PRJNA387191", refseq:"NC_034611.1"
NC_034611.1:21581612-21581626
GCAAACCTCTTAATATCCTTGAATTTTTGA21581612TTCATTGACAACATTTTTGGTTTTAACTGGGTGACTCTTGATGAT
Fragaria vesca subsp. vesca linkage group LG6, FraVesHawaii_1.0, whole genome shotgun sequence.
taxonomy:"101020", bioproject:"PRJNA66853", refseq:"NC_020496.1"
NC_020496.1:7676434-7676448
GTCGTCTTACTTGGGACAGCCGCTTCCATT7676434TTCATTGACAACATTGATCTGGATCGAGGTTCTGGTGATCGGCTA
Rattus norvegicus strain BN/NHsdMcwi chromosome 2, mRatBN7.2, whole genome shotgun sequence.
taxonomy:"10116", bioproject:"PRJNA677964", refseq:"NC_051337.1"
NC_051337.1:41984772-41984786
TTTTCAAAATCTTTTGCCTGTATAGACTTT41984772TTCATTGACAACATTAAACTGTATGACATGCAAAAAATAACAGGT
Rattus norvegicus strain BN/NHsdMcwi chromosome 2, mRatBN7.2, whole genome shotgun sequence.
taxonomy:"10116", bioproject:"PRJNA677964", refseq:"NC_051337.1"
NC_051337.1:57228929-57228943
CCTCTCCCATTTACATTTAGTTTTAAGTAA57228929TTCATTGACAACATTTTTTGCATTGTTCAGCCCTTTACCTGTATT
Rattus norvegicus strain BN/NHsdMcwi chromosome 2, mRatBN7.2, whole genome shotgun sequence.
taxonomy:"10116", bioproject:"PRJNA677964", refseq:"NC_051337.1"
NC_051337.1:59328893-59328907
CTGAACTTTCACCATAACAACCCATTAGGT59328893TTCATTGACAACATTCTATGGCAGCTATAGACCCCAACTCCAAAT
Rattus norvegicus strain BN/NHsdMcwi chromosome 4, mRatBN7.2, whole genome shotgun sequence.
taxonomy:"10116", bioproject:"PRJNA677964", refseq:"NC_051339.1"
NC_051339.1:160381290-160381304
AAACTGCGCTAAGCAAGACGGTATGGTATT160381290TTCATTGACAACATTAAAGAAAATAGAGAGATAGACACTCGTGTG
Rattus norvegicus strain BN/NHsdMcwi chromosome 14, mRatBN7.2, whole genome shotgun sequence.
taxonomy:"10116", bioproject:"PRJNA677964", refseq:"NC_051349.1"
NC_051349.1:30092986-30093000
GAAGCTAATAGTGCAATCGCCATGGTCTCC30092986TTCATTGACAACATTAACAGCTGTAATAAAATCAAGATATTGGCA
Rattus norvegicus strain BN/NHsdMcwi chromosome 18, mRatBN7.2, whole genome shotgun sequence.
taxonomy:"10116", bioproject:"PRJNA677964", refseq:"NC_051353.1"
NC_051353.1:23542900-23542914
ACATTCCTTACTCCTCTGACAGCAGTTTCT23542900TTCATTGACAACATTCAGGCTATCAGGCCTGATGTTGAGGTCCTT
Rattus rattus isolate New Zealand chromosome 1, Rrattus_CSIRO_v1, whole genome shotgun sequence.
taxonomy:"10117", bioproject:"PRJNA612505", refseq:"NC_046154.1"
NC_046154.1:73019131-73019145
TTTTTCAGATTATTTGATGAACAGATCTAT73019131TTCATTGACAACATTAAAGTTTCAAATGTATAATTGTTGACAATG
Rattus rattus isolate New Zealand chromosome 1, Rrattus_CSIRO_v1, whole genome shotgun sequence.
taxonomy:"10117", bioproject:"PRJNA612505", refseq:"NC_046154.1"
NC_046154.1:197289849-197289863
ATGAACAGATACCATGACCAAAGCAACAAT197289849TTCATTGACAACATTTAATTGGGGCTGGCTTACAGGTTCAGAGAG
Rattus rattus isolate New Zealand chromosome 1, Rrattus_CSIRO_v1, whole genome shotgun sequence.
taxonomy:"10117", bioproject:"PRJNA612505", refseq:"NC_046154.1"
NC_046154.1:246612330-246612344
ACTTCTCGCCTTTTACCATCCCTTATATCT246612330TTCATTGACAACATTGGACTGGTGGTCAGGCTTAGCCTTTGGGGT
Rattus rattus isolate New Zealand chromosome 3, Rrattus_CSIRO_v1, whole genome shotgun sequence.
taxonomy:"10117", bioproject:"PRJNA612505", refseq:"NC_046156.1"
NC_046156.1:221577579-221577593
TGAATGAAAGGTCAGAGTTCAAGGTGTGAT221577579TTCATTGACAACATTAAATATTTACTGAATCTTAAATCTTATCCT
Rattus rattus isolate New Zealand chromosome 4, Rrattus_CSIRO_v1, whole genome shotgun sequence.
taxonomy:"10117", bioproject:"PRJNA612505", refseq:"NC_046157.1"
NC_046157.1:8207259-8207273
TTTTTAACCTTCTTTTCTTATTGTTAAATT8207259TTCATTGACAACATTTTCCTTTTGGTGTAATTTTAAAAAGAATAA
Rattus rattus isolate New Zealand chromosome 6, Rrattus_CSIRO_v1, whole genome shotgun sequence.
taxonomy:"10117", bioproject:"PRJNA612505", refseq:"NC_046159.1"
NC_046159.1:83566318-83566332
GCTTTCCAGTAGGTGACAACACATGTGCAT83566318TTCATTGACAACATTGATTTCCTTCCTTGTATCCGCTACACATAC
Rattus rattus isolate New Zealand chromosome 6, Rrattus_CSIRO_v1, whole genome shotgun sequence.
taxonomy:"10117", bioproject:"PRJNA612505", refseq:"NC_046159.1"
NC_046159.1:142412968-142412982
CAGAAATATCCACAGATTTATATTGTCCAT142412968TTCATTGACAACATTTTGGTGGTATCTCCAGATGAAAAGGAATTG
Prunus mume isolate 4 linkage group LG6, P.mume_V1.0, whole genome shotgun sequence.
taxonomy:"102107", bioproject:"PRJNA246160", refseq:"NC_024131.1"
NC_024131.1:5831687-5831701
TCCTATTTTGATACAATAATAACTAGGCAA5831687TTCATTGACAACATTTTAGTGAAACATGTGAACAACAAGAGGAAA
Prunus mume isolate 4 linkage group LG8, P.mume_V1.0, whole genome shotgun sequence.
taxonomy:"102107", bioproject:"PRJNA246160", refseq:"NC_024133.1"
NC_024133.1:8675412-8675426
AACAAACAATTTTAGTACGTGAAACCTTAA8675412TTCATTGACAACATTCTACAGGAATTTATTAATCTATCTTTCGAG
Benincasa hispida cultivar B227 chromosome 12, ASM972705v1, whole genome shotgun sequence.
taxonomy:"102211", bioproject:"PRJNA691418", refseq:"NC_052360.1"
NC_052360.1:26272039-26272053
CGTGATGCTGAAGGACAGGATGTGCTTCTC26272039TTCATTGACAACATTTTCCGCTTTACCCAGGTAAATTTGCTAGAA
Benincasa hispida cultivar B227 chromosome 12, ASM972705v1, whole genome shotgun sequence.
taxonomy:"102211", bioproject:"PRJNA691418", refseq:"NC_052360.1"
NC_052360.1:75161024-75161038
GGAATTACTTCAAACAAAACTTAACTTAGT75161024TTCATTGACAACATTAAAATTAACGTACGGGAACAGGGGTGCCAA
Arvicola amphibius chromosome 5, mArvAmp1.2, whole genome shotgun sequence.
taxonomy:"1047088", bioproject:"PRJNA687149", refseq:"NC_052051.1"
NC_052051.1:108296074-108296088
TGGGAAGAAGATAAGATTGGCTGAATGGAG108296074TTCATTGACAACATTCTTACTCTCATTTAGATAATAACCTGTCCC
Arvicola amphibius chromosome 7, mArvAmp1.2, whole genome shotgun sequence.
taxonomy:"1047088", bioproject:"PRJNA687149", refseq:"NC_052053.1"
NC_052053.1:87019988-87020002
TGAGTAAAGCTGAATATCACTGGGGATTAT87019988TTCATTGACAACATTTATTATTAGTATTAGTATTATTAATATTAG
Nothobranchius furzeri strain GRZ chromosome sgr02, Nfu_20140520, whole genome shotgun sequence.
taxonomy:"105023", bioproject:"PRJNA314891", refseq:"NC_029650.1"
NC_029650.1:11877290-11877304
TTATGCATAAGCAGCAACATAAGCAGTTAT11877290TTCATTGACAACATTTTCTTGTGGAGTGGCAGTGGACTAAGAAAG
Nothobranchius furzeri strain GRZ chromosome sgr03, Nfu_20140520, whole genome shotgun sequence.
taxonomy:"105023", bioproject:"PRJNA314891", refseq:"NC_029651.1"
NC_029651.1:56682950-56682964
TATTTTGGAGAAATATAATCCAGACATTAT56682950TTCATTGACAACATTCACTATCACACATCATAGCCCCATCACACA
Nothobranchius furzeri strain GRZ chromosome sgr12, Nfu_20140520, whole genome shotgun sequence.
taxonomy:"105023", bioproject:"PRJNA314891", refseq:"NC_029660.1"
NC_029660.1:35843992-35844006
GTTTTCCAGCGCTTCCAAAGAATAAAGGAC35843992TTCATTGACAACATTTAAAATATTTGATGATCCCTCATTGGAACG
Maylandia zebra isolate #2_Kocher and #3_Kocher ecotype Mazinzi reef linkage group LG1, M_zebra_UMD2a, whole genome shotgun sequence.
taxonomy:"106582", bioproject:"PRJNA198780", refseq:"NC_036780.1"
NC_036780.1:7430766-7430780
AGAGCTGCTTTAACCGATTAGAAGCAATTA7430766TTCATTGACAACATTCAAGTAATGCTCAGGTGATAAAAGTAAGCA
Maylandia zebra isolate #2_Kocher and #3_Kocher ecotype Mazinzi reef linkage group LG3, M_zebra_UMD2a, whole genome shotgun sequence.
taxonomy:"106582", bioproject:"PRJNA198780", refseq:"NC_036782.1"
NC_036782.1:16697971-16697985
TAATAGTGTTAAAGATTTTTAAAGGCATCC16697971TTCATTGACAACATTGTGTCTCTTTGACTTCACACAATGAATAAC
Maylandia zebra isolate #2_Kocher and #3_Kocher ecotype Mazinzi reef linkage group LG16, M_zebra_UMD2a, whole genome shotgun sequence.
taxonomy:"106582", bioproject:"PRJNA198780", refseq:"NC_036795.1"
NC_036795.1:1698880-1698894
GCCCAACAGGCCCACAGAACCACCAACTTT1698880TTCATTGACAACATTTTGAGACCGGACTTTGGCTGCAAGAAGGAG
Gopherus evgoodei ecotype Sinaloan lineage chromosome 7, rGopEvg1_v1.p, whole genome shotgun sequence.
taxonomy:"1825980", bioproject:"PRJNA559383", refseq:"NC_044328.1"
NC_044328.1:113643173-113643187
TAATAGAAAGTCTTCCTAATTACATATTCC113643173TTCATTGACAACATTGTCTCCATCCATGAAAGATGGATGAGAGTT
Gopherus evgoodei ecotype Sinaloan lineage chromosome 8, rGopEvg1_v1.p, whole genome shotgun sequence.
taxonomy:"1825980", bioproject:"PRJNA559383", refseq:"NC_044329.1"
NC_044329.1:87138609-87138623
TGGACTAGAGCTGGCTGGAGGAAAATGCAA87138609TTCATTGACAACATTTGAGATTTTGAAATTTATTTATGAAAACAA
Gopherus evgoodei ecotype Sinaloan lineage chromosome 16, rGopEvg1_v1.p, whole genome shotgun sequence.
taxonomy:"1825980", bioproject:"PRJNA559383", refseq:"NC_044337.1"
NC_044337.1:1987362-1987376
TGGGGTATTTTGTGAATAGTGAGTTTTCCC1987362TTCATTGACAACATTTTCATTTTGGGAGAGAAGTTCTGACCAGAT
Maniola jurtina chromosome 1, ilManJurt1.1, whole genome shotgun sequence.
taxonomy:"191418", bioproject:"PRJNA795494", refseq:"NC_060029.1"
NC_060029.1:941283-941297
CCGGTAGAATGTATAAATTGCTGACAAAAA941283TTCATTGACAACATTCCTTGGTAGACCAATATTGAATTACTCATC
Maniola jurtina chromosome 5, ilManJurt1.1, whole genome shotgun sequence.
taxonomy:"191418", bioproject:"PRJNA795494", refseq:"NC_060033.1"
NC_060033.1:2779724-2779738
CAAAACCGTTTTCGAATCGAATTTCGAATG2779724TTCATTGACAACATTATGTACTCTATAACATAGTTTCGTTTGTGA
Synechococcus lividus PCC 6715 chromosome, complete genome.
taxonomy:"1917166", bioproject:"PRJNA224116", refseq:"NZ_CP018092.1"
NZ_CP018092.1:605902-605916
TTCAACCTTGACCCACCACGCTAAACCAAT605902TTCATTGACAACATTGGCCAGCCAGCCAGTAAAGGTTGTGTTATT
Gracilinanus agilis isolate LMUSP501 chromosome 1, AgileGrace, whole genome shotgun sequence.
taxonomy:"191870", bioproject:"PRJNA769689", refseq:"NC_058130.1"
NC_058130.1:621354810-621354824
AAATATGCATAGTCAAATAACACAAATTCC621354810TTCATTGACAACATTCAAAAATATAAATGGGATATAGAATGTATC
Gracilinanus agilis isolate LMUSP501 chromosome 1, AgileGrace, whole genome shotgun sequence.
taxonomy:"191870", bioproject:"PRJNA769689", refseq:"NC_058130.1"
NC_058130.1:660388007-660388021
TCATTTGTTAAAATATCCTAACCCCGTAAA660388007TTCATTGACAACATTTCTTACCATATCATTTTCATGAAAAAGAAA
Gracilinanus agilis isolate LMUSP501 chromosome 2, AgileGrace, whole genome shotgun sequence.
taxonomy:"191870", bioproject:"PRJNA769689", refseq:"NC_058131.1"
NC_058131.1:433259553-433259567
CCATTTCCCCATGTTAATTAGACAAATTTC433259553TTCATTGACAACATTCTTTAAATAACATGTAGTTACTAGAGGGTT
Gracilinanus agilis isolate LMUSP501 chromosome 3, AgileGrace, whole genome shotgun sequence.
taxonomy:"191870", bioproject:"PRJNA769689", refseq:"NC_058132.1"
NC_058132.1:320119665-320119679
ATAAATGCTTATTCCCTTCCCTTCCCCTTC320119665TTCATTGACAACATTATCTTCCATCTCTGCATCTTTGTAGAGGCT
Gracilinanus agilis isolate LMUSP501 chromosome 3, AgileGrace, whole genome shotgun sequence.
taxonomy:"191870", bioproject:"PRJNA769689", refseq:"NC_058132.1"
NC_058132.1:665053543-665053557
CCAGTCCAGAGAACTCCTTCCAGATTCCTT665053543TTCATTGACAACATTGAATTTTGTATCTTACAAAAAAGGGTCTAA
Gracilinanus agilis isolate LMUSP501 chromosome 6, AgileGrace, whole genome shotgun sequence.
taxonomy:"191870", bioproject:"PRJNA769689", refseq:"NC_058135.1"
NC_058135.1:20664192-20664206
AAAAATTTTTTTAAAGCAGAACCTGTGATT20664192TTCATTGACAACATTTACATGTTGTCTTACAAAGTTTGCATCATG
Gracilinanus agilis isolate LMUSP501 chromosome 6, AgileGrace, whole genome shotgun sequence.
taxonomy:"191870", bioproject:"PRJNA769689", refseq:"NC_058135.1"
NC_058135.1:182732182-182732196
TGTCTCTGTTTCGGATTCTCTGTAATTATC182732182TTCATTGACAACATTGTCCTTGCCAGTGTCACCATCTCTCTTTTT
Rhinatrema bivittatum chromosome 1, aRhiBiv1.1, whole genome shotgun sequence.
taxonomy:"194408", bioproject:"PRJNA549481", refseq:"NC_042615.1"
NC_042615.1:77667568-77667582
CTATATAAAGGATTCCACAGATTTTATTAA77667568TTCATTGACAACATTACAGTATATAGAATCGGATTGGCTATTGGT
Rhinatrema bivittatum chromosome 1, aRhiBiv1.1, whole genome shotgun sequence.
taxonomy:"194408", bioproject:"PRJNA549481", refseq:"NC_042615.1"
NC_042615.1:291790719-291790733
TTAATTCATTATTGTAAGATCCAACTGTTT291790719TTCATTGACAACATTTGGTCTTTCCATAACAATCCAATGTTTGCC
Rhinatrema bivittatum chromosome 1, aRhiBiv1.1, whole genome shotgun sequence.
taxonomy:"194408", bioproject:"PRJNA549481", refseq:"NC_042615.1"
NC_042615.1:685255842-685255856
GTGGCATCAGTAGGCTACCTGAGATCAGCG685255842TTCATTGACAACATTTACAAAGCTGTGAAATGGCATTCTCTCCAC
Rhinatrema bivittatum chromosome 4, aRhiBiv1.1, whole genome shotgun sequence.
taxonomy:"194408", bioproject:"PRJNA549481", refseq:"NC_042618.1"
NC_042618.1:126973452-126973466
TACAAAAAGAATATCCTAGTGTGGCGCCGT126973452TTCATTGACAACATTTTCATTGTGTGGCATGGGACTGAGGTCCTT
Rhinatrema bivittatum chromosome 5, aRhiBiv1.1, whole genome shotgun sequence.
taxonomy:"194408", bioproject:"PRJNA549481", refseq:"NC_042619.1"
NC_042619.1:83107814-83107828
GTGGTAGAGTATAAATACGATCTAATGTTT83107814TTCATTGACAACATTTGGTCAAGGTATCTATCATTTGATTGACAG
Rhinatrema bivittatum chromosome 6, aRhiBiv1.1, whole genome shotgun sequence.
taxonomy:"194408", bioproject:"PRJNA549481", refseq:"NC_042620.1"
NC_042620.1:211000394-211000408
TGGTGGGCAGACATCAAATGCTGGCTTCAT211000394TTCATTGACAACATTTTCTTCATTTGGATAGGTTCAGATCAACAA
Rhinatrema bivittatum chromosome 6, aRhiBiv1.1, whole genome shotgun sequence.
taxonomy:"194408", bioproject:"PRJNA549481", refseq:"NC_042620.1"
NC_042620.1:346678529-346678543
CAGTTTCAACATATTGTATTTTGGATGAGA346678529TTCATTGACAACATTTTTTTTTTTTATTTGGAAGTCTGATTTTTC
Rhinatrema bivittatum chromosome 7, aRhiBiv1.1, whole genome shotgun sequence.
taxonomy:"194408", bioproject:"PRJNA549481", refseq:"NC_042621.1"
NC_042621.1:39631119-39631133
TCTTCATTCAACATTTCCCGCTGCGTTTTC39631119TTCATTGACAACATTGACTGTACACCCATCGGGGTTAAACAAAGA
Rhinatrema bivittatum chromosome 7, aRhiBiv1.1, whole genome shotgun sequence.
taxonomy:"194408", bioproject:"PRJNA549481", refseq:"NC_042621.1"
NC_042621.1:194531118-194531132
ATGTAAAGGTCAGCGAAGGGTTGCAAATCT194531118TTCATTGACAACATTTTGAGCTATATTTAAGGACAGCTTTTGCAC
Hippoglossus stenolepis isolate PH-IPHC-18 chromosome 23, IPHC_HiSten_1.0, whole genome shotgun sequence.
taxonomy:"195615", bioproject:"PRJNA642014", refseq:"NC_048949.1"
NC_048949.1:15326810-15326824
AGAAAGTCCATATAATAACAGCCAAACTAG15326810TTCATTGACAACATTTGTACATAGTGTAAATTTATACAAATGAAG
Homalodisca vitripennis isolate AUS2020 chromosome 1, UT_GWSS_2.1, whole genome shotgun sequence.
taxonomy:"197043", bioproject:"PRJNA801498", refseq:"NC_060207.1"
NC_060207.1:16060817-16060831
TTATAGACAATACACTGGATAGCGTGTTAG16060817TTCATTGACAACATTTACAGATGGGTCAAGGGTCGAAAATGTCAG
Homalodisca vitripennis isolate AUS2020 chromosome 1, UT_GWSS_2.1, whole genome shotgun sequence.
taxonomy:"197043", bioproject:"PRJNA801498", refseq:"NC_060207.1"
NC_060207.1:128988237-128988251
GAGGGCACTACAACGAGAGTTTTACTGACT128988237TTCATTGACAACATTGACTTTCAACTCTATTATTTTCATTTTGAC
Homalodisca vitripennis isolate AUS2020 chromosome 2, UT_GWSS_2.1, whole genome shotgun sequence.
taxonomy:"197043", bioproject:"PRJNA801498", refseq:"NC_060208.1"
NC_060208.1:43384891-43384905
GCTGTCCAGTGTCCAGTGAGTTTTACACTG43384891TTCATTGACAACATTCTTGTTTAAATTTTGTTGTTGACAATCGAA
Homalodisca vitripennis isolate AUS2020 chromosome 2, UT_GWSS_2.1, whole genome shotgun sequence.
taxonomy:"197043", bioproject:"PRJNA801498", refseq:"NC_060208.1"
NC_060208.1:133086770-133086784
TGTATTCGTTAAAAAAGAACTATGTATATG133086770TTCATTGACAACATTTAAATGCTATGAACTTAAGTAGAACGCAGG
Homalodisca vitripennis isolate AUS2020 chromosome 2, UT_GWSS_2.1, whole genome shotgun sequence.
taxonomy:"197043", bioproject:"PRJNA801498", refseq:"NC_060208.1"
NC_060208.1:155235609-155235623
ATCTAGAAGTGGTAATTAATTTAAGTAAGG155235609TTCATTGACAACATTGATTTCCAAGATTATGCTCAGTCTCACATA
Homalodisca vitripennis isolate AUS2020 chromosome 2, UT_GWSS_2.1, whole genome shotgun sequence.
taxonomy:"197043", bioproject:"PRJNA801498", refseq:"NC_060208.1"
NC_060208.1:174984090-174984104
TTATCAAACAATATGAATAACTTGTACAAG174984090TTCATTGACAACATTATTAAAAACTATATGTTTGTTTTCAGGTAA
Homalodisca vitripennis isolate AUS2020 chromosome 3, UT_GWSS_2.1, whole genome shotgun sequence.
taxonomy:"197043", bioproject:"PRJNA801498", refseq:"NC_060209.1"
NC_060209.1:142222936-142222950
CCCCCCTTCACCAACACCCTTTTTCACACC142222936TTCATTGACAACATTCATTTGTAATTGAATGATGTCCCGCCCTTG
Homalodisca vitripennis isolate AUS2020 chromosome 3, UT_GWSS_2.1, whole genome shotgun sequence.
taxonomy:"197043", bioproject:"PRJNA801498", refseq:"NC_060209.1"
NC_060209.1:161468979-161468993
CAAAGAGCTTTTACTTGAGATTAGCATGAA161468979TTCATTGACAACATTCACATCCAAGTAAAGTAAATGAGGAGTTTT
Homalodisca vitripennis isolate AUS2020 chromosome 4, UT_GWSS_2.1, whole genome shotgun sequence.
taxonomy:"197043", bioproject:"PRJNA801498", refseq:"NC_060210.1"
NC_060210.1:70413965-70413979
AATTCCCTTATAAAGACGGAGTTTTAAGAA70413965TTCATTGACAACATTCACAATAAAAGAATAACTTATATAGTTATT
Homalodisca vitripennis isolate AUS2020 chromosome 4, UT_GWSS_2.1, whole genome shotgun sequence.
taxonomy:"197043", bioproject:"PRJNA801498", refseq:"NC_060210.1"
NC_060210.1:195615999-195616013
GCACAACCCACCAGTAGTCTGAATTAGCAC195615999TTCATTGACAACATTAACTCTACTACTGCTGACTCCCTCTTAGTC
Homalodisca vitripennis isolate AUS2020 chromosome 5, UT_GWSS_2.1, whole genome shotgun sequence.
taxonomy:"197043", bioproject:"PRJNA801498", refseq:"NC_060211.1"
NC_060211.1:53307461-53307475
TGTACACTTAGATTTAATGTTCAACGTTTG53307461TTCATTGACAACATTTGTTCACATCTTTGTTTGGTTCTGCCTGTA
Homalodisca vitripennis isolate AUS2020 chromosome 7, UT_GWSS_2.1, whole genome shotgun sequence.
taxonomy:"197043", bioproject:"PRJNA801498", refseq:"NC_060213.1"
NC_060213.1:119700787-119700801
TCTTCAATCGCATTATTAGCAGTTGTTATC119700787TTCATTGACAACATTTCTATTATCAAAACAAATTTTATTAAATCT
Homalodisca vitripennis isolate AUS2020 chromosome X, UT_GWSS_2.1, whole genome shotgun sequence.
taxonomy:"197043", bioproject:"PRJNA801498", refseq:"NC_060215.1"
NC_060215.1:43253114-43253128
AATGCCGGTAGGTCCAAGTTCTGCGAGGTC43253114TTCATTGACAACATTCAGTATTACACAAAGGAAATGGGCAAACTT
Homalodisca vitripennis isolate AUS2020 chromosome X, UT_GWSS_2.1, whole genome shotgun sequence.
taxonomy:"197043", bioproject:"PRJNA801498", refseq:"NC_060215.1"
NC_060215.1:105964722-105964736
ATGGATTTCCTGCAAAAGGGTCATGCTTTG105964722TTCATTGACAACATTTTTGGTACATATATATGAAAAAATATACTA
Ischnura elegans chromosome 2, ioIscEleg1.1, whole genome shotgun sequence.
taxonomy:"197161", bioproject:"PRJNA802257", refseq:"NC_060247.1"
NC_060247.1:116757077-116757091
TTAAACGAAAACATTTTCAACGACAACATT116757077TTCATTGACAACATTTTCAACGACAACATTTTCAACGACAACATT
Ischnura elegans chromosome 2, ioIscEleg1.1, whole genome shotgun sequence.
taxonomy:"197161", bioproject:"PRJNA802257", refseq:"NC_060247.1"
NC_060247.1:116766177-116766191
TTAAACGAAAACATTTTCAACGACAACATT116766177TTCATTGACAACATTTCAACGTCATAATTTTAAACGACAACATTT
Ischnura elegans chromosome 2, ioIscEleg1.1, whole genome shotgun sequence.
taxonomy:"197161", bioproject:"PRJNA802257", refseq:"NC_060247.1"
NC_060247.1:116779039-116779053
TTAAACGAAAACATTTTCAACGACAACATT116779039TTCATTGACAACATTTCAACGTCATAATTTTCAACGACAACATTT
Ischnura elegans chromosome 2, ioIscEleg1.1, whole genome shotgun sequence.
taxonomy:"197161", bioproject:"PRJNA802257", refseq:"NC_060247.1"
NC_060247.1:116794476-116794490
TTAAACGAAAACATTTTCAACGACAACATT116794476TTCATTGACAACATTTCAACGTCATAATTTTCAACGACAACATTT
Ischnura elegans chromosome 2, ioIscEleg1.1, whole genome shotgun sequence.
taxonomy:"197161", bioproject:"PRJNA802257", refseq:"NC_060247.1"
NC_060247.1:116797998-116798012
TTAAACGAAAACATTTTCAACGACAACATT116797998TTCATTGACAACATTTCAACGTCATAATTTTCAACGACAACATTT
Ischnura elegans chromosome 2, ioIscEleg1.1, whole genome shotgun sequence.
taxonomy:"197161", bioproject:"PRJNA802257", refseq:"NC_060247.1"
NC_060247.1:116799102-116799116
TTAAACGAAAACATTTTCAACGACAACATT116799102TTCATTGACAACATTTCAACGTCATAATTTTCAACGACAACATTT
Ischnura elegans chromosome 2, ioIscEleg1.1, whole genome shotgun sequence.
taxonomy:"197161", bioproject:"PRJNA802257", refseq:"NC_060247.1"
NC_060247.1:116802430-116802444
TTAAACGAAAACATTTTCAACGACAACATT116802430TTCATTGACAACATTTCAACGTCATAATTTTCAACGACAACATTT
Ischnura elegans chromosome 2, ioIscEleg1.1, whole genome shotgun sequence.
taxonomy:"197161", bioproject:"PRJNA802257", refseq:"NC_060247.1"
NC_060247.1:116803535-116803549
TTAAACGAAAACATTTTCAACGACAACATT116803535TTCATTGACAACATTTCAACGTCATAATTTTCAACGACAACATTT
Ischnura elegans chromosome 2, ioIscEleg1.1, whole genome shotgun sequence.
taxonomy:"197161", bioproject:"PRJNA802257", refseq:"NC_060247.1"
NC_060247.1:116806967-116806981
TTAAACGAAAACATTTTCAACGACAACATT116806967TTCATTGACAACATTTCAACGTCATAATTTTCAACGACAACATTT
Ischnura elegans chromosome 2, ioIscEleg1.1, whole genome shotgun sequence.
taxonomy:"197161", bioproject:"PRJNA802257", refseq:"NC_060247.1"
NC_060247.1:116808517-116808531
TTAAACGAAAACATTTTCAACGACAACATT116808517TTCATTGACAACATTTCAACGTCATAATTTTCAACGACAACATTT
Ischnura elegans chromosome 2, ioIscEleg1.1, whole genome shotgun sequence.
taxonomy:"197161", bioproject:"PRJNA802257", refseq:"NC_060247.1"
NC_060247.1:116812668-116812682
TTAAACGAAAACATTTTCAACGACAACATT116812668TTCATTGACAACATTTCAACGTCATAATTTTAAACGACAACATTT
Ischnura elegans chromosome 2, ioIscEleg1.1, whole genome shotgun sequence.
taxonomy:"197161", bioproject:"PRJNA802257", refseq:"NC_060247.1"
NC_060247.1:116847694-116847708
TGAAACGAAAACATTTTCAACGACAACATT116847694TTCATTGACAACATTTTCAACGTCATAATTTTCAACGACAACATT
Ischnura elegans chromosome 2, ioIscEleg1.1, whole genome shotgun sequence.
taxonomy:"197161", bioproject:"PRJNA802257", refseq:"NC_060247.1"
NC_060247.1:116850533-116850547
TGAAACGAAAACATTTTCAACGACAACATT116850533TTCATTGACAACATTTTCAACGTCATAATTTTCAACGACAACATT
Vespula pensylvanica isolate Volc-1 chromosome 9, ASM1446617v1, whole genome shotgun sequence.
taxonomy:"30213", bioproject:"PRJNA761702", refseq:"NC_057693.1"
NC_057693.1:6579965-6579979
AAAAAAAAGAAAAAATCCTTCAAAAATTGT6579965TTCATTGACAACATTTTAGAAATAAATTCAGACTTATCGACTGAC
Bufo gargarizans isolate SCDJY-AF-19 chromosome 1, ASM1485885v1, whole genome shotgun sequence.
taxonomy:"30331", bioproject:"PRJNA769289", refseq:"NC_058080.1"
NC_058080.1:209672882-209672896
CAGTACGGTGGTATCTCTTCTCCTAACACG209672882TTCATTGACAACATTTCATGTCGGTAGCACATAATTGCTCATTAG
Bufo gargarizans isolate SCDJY-AF-19 chromosome 2, ASM1485885v1, whole genome shotgun sequence.
taxonomy:"30331", bioproject:"PRJNA769289", refseq:"NC_058081.1"
NC_058081.1:609242252-609242266
TATTTGAAAAATGTTTTAACATGGAAAAGA609242252TTCATTGACAACATTTTTTGCGTGTGGGCAGGGCCTCGTGAGACC
Bufo gargarizans isolate SCDJY-AF-19 chromosome 3, ASM1485885v1, whole genome shotgun sequence.
taxonomy:"30331", bioproject:"PRJNA769289", refseq:"NC_058082.1"
NC_058082.1:398603721-398603735
AGGCAACTTCACATCCTAGTCTTGACCGAA398603721TTCATTGACAACATTCTTTTGAATGTTGACAATGGTTTGGTTGTA
Bufo gargarizans isolate SCDJY-AF-19 chromosome 4, ASM1485885v1, whole genome shotgun sequence.
taxonomy:"30331", bioproject:"PRJNA769289", refseq:"NC_058083.1"
NC_058083.1:32419514-32419528
TGCCCCAAAAAACCCTTGGCCTACTTCCGT32419514TTCATTGACAACATTCTAATGATCTGGACCGACTCTGAACATGAA
Bufo gargarizans isolate SCDJY-AF-19 chromosome 4, ASM1485885v1, whole genome shotgun sequence.
taxonomy:"30331", bioproject:"PRJNA769289", refseq:"NC_058083.1"
NC_058083.1:137841663-137841677
AGTGAATGTGGTAGTATATGTTGGTTCAGA137841663TTCATTGACAACATTTTCTGCATATGGAATGGGTCCCAAACCTCC
Bufo gargarizans isolate SCDJY-AF-19 chromosome 4, ASM1485885v1, whole genome shotgun sequence.
taxonomy:"30331", bioproject:"PRJNA769289", refseq:"NC_058083.1"
NC_058083.1:235529173-235529187
GGAGTCGATCATGTCATACTCTGGTCCCGC235529173TTCATTGACAACATTTTCATCATTTGGAGTGGGACAGAGATGAAC
Bufo gargarizans isolate SCDJY-AF-19 chromosome 4, ASM1485885v1, whole genome shotgun sequence.
taxonomy:"30331", bioproject:"PRJNA769289", refseq:"NC_058083.1"
NC_058083.1:397777663-397777677
TACCAAAAATTTGCACTGGTGGGGAAAAGG397777663TTCATTGACAACATTTTTTGGCGTATGGGCGGGGCCACTCGTGCC
Bufo gargarizans isolate SCDJY-AF-19 chromosome 4, ASM1485885v1, whole genome shotgun sequence.
taxonomy:"30331", bioproject:"PRJNA769289", refseq:"NC_058083.1"
NC_058083.1:479486626-479486640
GCTACAAGTGATATTGTTCTCTGGACCCGC479486626TTCATTGACAACATTTTCGTCATCTGGAGTGGGTCCAGAGAAACA
Bufo gargarizans isolate SCDJY-AF-19 chromosome 5, ASM1485885v1, whole genome shotgun sequence.
taxonomy:"30331", bioproject:"PRJNA769289", refseq:"NC_058084.1"
NC_058084.1:260706564-260706578
TTTCAACAACGTGCCATCATTTGGCTATGA260706564TTCATTGACAACATTTTTTTGCTTTTGGGGAGGACCACTATCCAG
Bufo gargarizans isolate SCDJY-AF-19 chromosome 6, ASM1485885v1, whole genome shotgun sequence.
taxonomy:"30331", bioproject:"PRJNA769289", refseq:"NC_058085.1"
NC_058085.1:58762208-58762222
AATAAATCAGAATATCATCCAAATAAACTA58762208TTCATTGACAACATTTTGGAGACCGCCGGAGCATTACTTAAACCA
Bufo gargarizans isolate SCDJY-AF-19 chromosome 7, ASM1485885v1, whole genome shotgun sequence.
taxonomy:"30331", bioproject:"PRJNA769289", refseq:"NC_058086.1"
NC_058086.1:85845042-85845056
AGGCAATTTGACATCCCAGTCCTTACCAGA85845042TTCATTGACAACATTTTTCAGGATGTTTACAATGGACTGGTTGTA
Bufo gargarizans isolate SCDJY-AF-19 chromosome 7, ASM1485885v1, whole genome shotgun sequence.
taxonomy:"30331", bioproject:"PRJNA769289", refseq:"NC_058086.1"
NC_058086.1:144958426-144958440
TTCCACCAATTCTCTGTCATGTGGCTTCGC144958426TTCATTGACAACATTTTTTGCATATGGAGGGGACCCACCTACACC
Bos indicus x Bos taurus breed Angus x Brahman F1 hybrid chromosome 7, Bos_hybrid_MaternalHap_v2.0, whole genome shotgun sequence.
taxonomy:"30522", bioproject:"PRJNA508959", refseq:"NC_040082.1"
NC_040082.1:8473641-8473655
CATGATAACAATCTGAGTCATGTAGTTGAG8473641TTCATTGACAACATTTAAATAATCCATAGCTCGTTTCCACTGTTC
Bos indicus x Bos taurus breed Angus x Brahman F1 hybrid chromosome 7, Bos_hybrid_MaternalHap_v2.0, whole genome shotgun sequence.
taxonomy:"30522", bioproject:"PRJNA508959", refseq:"NC_040082.1"
NC_040082.1:46705352-46705366
ATATATGTTTTTAACCAGGGACTCTACACA46705352TTCATTGACAACATTGAAAAATCTCTTTCATTCCCTCCACACATC
Bos indicus x Bos taurus breed Angus x Brahman F1 hybrid chromosome 9, Bos_hybrid_MaternalHap_v2.0, whole genome shotgun sequence.
taxonomy:"30522", bioproject:"PRJNA508959", refseq:"NC_040084.1"
NC_040084.1:13955917-13955931
CCAGAGCTTCTGCTTCTATCCTGAATTAGG13955917TTCATTGACAACATTCCCTTCACCACCCTACTCTTTCTTATACTT
Bos indicus x Bos taurus breed Angus x Brahman F1 hybrid chromosome 19, Bos_hybrid_MaternalHap_v2.0, whole genome shotgun sequence.
taxonomy:"30522", bioproject:"PRJNA508959", refseq:"NC_040094.1"
NC_040094.1:23466143-23466157
CAGTGACTCCCCCTGACTCACTGCTTTAAA23466143TTCATTGACAACATTTTTTAAAAGGTAGAGAATTCTCATGAAAAG
Bos indicus x Bos taurus breed Angus x Brahman F1 hybrid chromosome 24, Bos_hybrid_MaternalHap_v2.0, whole genome shotgun sequence.
taxonomy:"30522", bioproject:"PRJNA508959", refseq:"NC_040099.1"
NC_040099.1:23966357-23966371
TAGAAGTTCTTAATGTTTGTTTTCTTGGCT23966357TTCATTGACAACATTCCTTTTTGTGTGACCTCATCCACTACCAGC
Bos indicus x Bos taurus breed Angus x Brahman F1 hybrid chromosome 24, Bos_hybrid_MaternalHap_v2.0, whole genome shotgun sequence.
taxonomy:"30522", bioproject:"PRJNA508959", refseq:"NC_040099.1"
NC_040099.1:60703203-60703217
ATACTTTCTCATTACAGAAAACAGCAATCG60703203TTCATTGACAACATTAACCTAAAAAAGTTCACCTACAACATTGTC
Microcebus murinus isolate mixed chromosome 1, Mmur_3.0, whole genome shotgun sequence.
taxonomy:"30608", bioproject:"PRJNA285159", refseq:"NC_033660.1"
NC_033660.1:82124077-82124091
ACTAAATAAATGTTGCATTAAAGAACAAGT82124077TTCATTGACAACATTGCAGTAAAATTGCTTTGCTTCTGACATTTC
Microcebus murinus isolate mixed chromosome 3, Mmur_3.0, whole genome shotgun sequence.
taxonomy:"30608", bioproject:"PRJNA285159", refseq:"NC_033662.1"
NC_033662.1:35611693-35611707
CAAAATATTTGGTTAAACAAAACCTCCTCT35611693TTCATTGACAACATTGTTTTGATGAAATGGATGAAAAGTTTCCCT
Microcebus murinus isolate mixed chromosome 3, Mmur_3.0, whole genome shotgun sequence.
taxonomy:"30608", bioproject:"PRJNA285159", refseq:"NC_033662.1"
NC_033662.1:79469337-79469351
ACAAGTTTCTGTTTTGCTCTCTTTTCTGAC79469337TTCATTGACAACATTACTAAATATATTAATAGCATACTGGAAAGC
Microcebus murinus isolate mixed chromosome 4, Mmur_3.0, whole genome shotgun sequence.
taxonomy:"30608", bioproject:"PRJNA285159", refseq:"NC_033663.1"
NC_033663.1:56276637-56276651
TAACATGTTTAAAAGAACGATTAATTGGCC56276637TTCATTGACAACATTTAAAATTAATTATTTTTACCCAATTAAGGA
Microcebus murinus isolate mixed chromosome 12, Mmur_3.0, whole genome shotgun sequence.
taxonomy:"30608", bioproject:"PRJNA285159", refseq:"NC_033671.1"
NC_033671.1:78332985-78332999
CATGATAACAATCTGAGTCATGTAGTTGAG78332985TTCATTGACAACATTTAAATAATCCATAGCTCTTTTCCACTGTTC
Microcebus murinus isolate mixed chromosome 15, Mmur_3.0, whole genome shotgun sequence.
taxonomy:"30608", bioproject:"PRJNA285159", refseq:"NC_033674.1"
NC_033674.1:11725580-11725594
TTTTTATGATTCTTAAAGGGTCATTTTATA11725580TTCATTGACAACATTTAGAAATGATTTTTGTAACTTTAAAATTAA
Microcebus murinus isolate mixed chromosome 17, Mmur_3.0, whole genome shotgun sequence.
taxonomy:"30608", bioproject:"PRJNA285159", refseq:"NC_033676.1"
NC_033676.1:31382399-31382413
TGGGCACACTGCTTTTCCCAGCTGGTGACT31382399TTCATTGACAACATTTTACAGACTGCAAGATGCCTGTGCTTGGCC
Microcebus murinus isolate mixed chromosome 31, Mmur_3.0, whole genome shotgun sequence.
taxonomy:"30608", bioproject:"PRJNA285159", refseq:"NC_033690.1"
NC_033690.1:20165393-20165407
ATAGATCACAAAATTACAAAATTGTATGTT20165393TTCATTGACAACATTTGAAAAATAAGGGGGTAGAAAAACCTGTTG
Oryzias melastigma strain HK-1 linkage group LG2, ASM292280v2, whole genome shotgun sequence.
taxonomy:"30732", bioproject:"PRJNA436980", refseq:"NC_050513.1"
NC_050513.1:16885510-16885524
ACATAATCAAAAGAAAAACACAACATTTTA16885510TTCATTGACAACATTTCCTCTTGACTGAATAAATCCACTATCAAA
Oryzias melastigma strain HK-1 linkage group LG5, ASM292280v2, whole genome shotgun sequence.
taxonomy:"30732", bioproject:"PRJNA436980", refseq:"NC_050516.1"
NC_050516.1:15830601-15830615
AAAAAAGTGGGAAACCCAAAGTTCTGTTTA15830601TTCATTGACAACATTTGGTTCTGGTTTTTGGAAGTTCTGACCTGT
Oryzias melastigma strain HK-1 linkage group LG7, ASM292280v2, whole genome shotgun sequence.
taxonomy:"30732", bioproject:"PRJNA436980", refseq:"NC_050518.1"
NC_050518.1:31651895-31651909
TGTAACCCTAACCTGCAGGTATTCAATGTG31651895TTCATTGACAACATTGACGAGAGGCTTCCCAGAATCGCTCTGTTC
Oryzias melastigma strain HK-1 linkage group LG13, ASM292280v2, whole genome shotgun sequence.
taxonomy:"30732", bioproject:"PRJNA436980", refseq:"NC_050524.1"
NC_050524.1:26959685-26959699
GAGTCACATTCTGTTACAAAGTGACTTACG26959685TTCATTGACAACATTGACATAAATGGTCCCTTTTCCGTGGATGCG
Oryzias melastigma strain HK-1 linkage group LG17, ASM292280v2, whole genome shotgun sequence.
taxonomy:"30732", bioproject:"PRJNA436980", refseq:"NC_050528.1"
NC_050528.1:28561434-28561448
ATGCGAATAGACGCTTCAACCCAGTGAAAC28561434TTCATTGACAACATTTTACTTGCCTTCAAAAATTAATGCAAATGC
Oryzias melastigma strain HK-1 linkage group LG22, ASM292280v2, whole genome shotgun sequence.
taxonomy:"30732", bioproject:"PRJNA436980", refseq:"NC_050533.1"
NC_050533.1:16695844-16695858
TGATTCAAAACATCAGCGTTTATCTGCAGA16695844TTCATTGACAACATTGGTTGTTTGAATTCACTCTCTGTTATTTTC
Monomorium pharaonis isolate MP-MQ-018 chromosome 2, ASM1337386v2, whole genome shotgun sequence.
taxonomy:"307658", bioproject:"PRJNA664199", refseq:"NC_050468.1"
NC_050468.1:15467366-15467380
CTTATTTCACTTTATCGGTCGCATTAATTA15467366TTCATTGACAACATTGACAATACATATTGATCTATCTGTTTATGA
Takifugu rubripes chromosome 6, fTakRub1.2, whole genome shotgun sequence.
taxonomy:"31033", bioproject:"PRJNA543527", refseq:"NC_042290.1"
NC_042290.1:2918971-2918985
GATTTAAAAATATATATATTTATTTTTTAC2918971TTCATTGACAACATTGTCTTAGTTGTGACTGATTAATACTATGAT
Takifugu rubripes chromosome 10, fTakRub1.2, whole genome shotgun sequence.
taxonomy:"31033", bioproject:"PRJNA543527", refseq:"NC_042294.1"
NC_042294.1:5132124-5132138
TATATTTTTATAATACAGATTATAATTCTT5132124TTCATTGACAACATTTCATTTTCTATTCAAAGTGGATTTTTTCAC
Takifugu rubripes chromosome 19, fTakRub1.2, whole genome shotgun sequence.
taxonomy:"31033", bioproject:"PRJNA543527", refseq:"NC_042303.1"
NC_042303.1:5646396-5646410
ACCTCTCACTCGCCACACTAGTTAAGTTTT5646396TTCATTGACAACATTGATTTCCAAGCCATCCGAATTTTTGTTTGT
Takifugu rubripes chromosome 22, fTakRub1.2, whole genome shotgun sequence.
taxonomy:"31033", bioproject:"PRJNA543527", refseq:"NC_042306.1"
NC_042306.1:14530880-14530894
TGCCACTGTTCTTTTACTGGACCACTGCAG14530880TTCATTGACAACATTAAATATCCCATACATGATTTAAAGACTATT
Epinephelus lanceolatus isolate Andai001 chromosome 6, ASM528154v1, whole genome shotgun sequence.
taxonomy:"310571", bioproject:"PRJNA625542", refseq:"NC_046996.1"
NC_046996.1:43935026-43935040
AGTACTCATATTTACTGTATTTGCAAAACA43935026TTCATTGACAACATTTTTATTTGTTTTCTTACAGTAGTCATAGTA
Epinephelus lanceolatus isolate Andai001 chromosome 7, ASM528154v1, whole genome shotgun sequence.
taxonomy:"310571", bioproject:"PRJNA625542", refseq:"NC_046997.1"
NC_046997.1:6948912-6948926
ATGTCCAAAACTATATTAAAAAAATTCTGC6948912TTCATTGACAACATTTTAAAAAACTGAGTCTGTCTTTGCTACTTA
Epinephelus lanceolatus isolate Andai001 chromosome 11, ASM528154v1, whole genome shotgun sequence.
taxonomy:"310571", bioproject:"PRJNA625542", refseq:"NC_047001.1"
NC_047001.1:42763278-42763292
CTGCGTGCCGCAGGCGAAGTCTGGGGGAAT42763278TTCATTGACAACATTCACTGTGAAACAACATCACGCTTGCTGCAT
Epinephelus lanceolatus isolate Andai001 chromosome 16, ASM528154v1, whole genome shotgun sequence.
taxonomy:"310571", bioproject:"PRJNA625542", refseq:"NC_047006.1"
NC_047006.1:34673923-34673937
CAGTATGAAGAACAGCAACTGATCAGATCC34673923TTCATTGACAACATTGAAAAACAGTCCCTTGATGCAATCAAGAGC
Epinephelus lanceolatus isolate Andai001 chromosome 16, ASM528154v1, whole genome shotgun sequence.
taxonomy:"310571", bioproject:"PRJNA625542", refseq:"NC_047006.1"
NC_047006.1:34715411-34715425
GACTTTGAAGAACAGGAACTGATCAGATCC34715411TTCATTGACAACATTGAACAACAGTCCCTTGATGTAATCAAGAGC
Epinephelus lanceolatus isolate Andai001 chromosome 20, ASM528154v1, whole genome shotgun sequence.
taxonomy:"310571", bioproject:"PRJNA625542", refseq:"NC_047010.1"
NC_047010.1:19014778-19014792
TGTGATTTTCTGCAGTTTTCTCATCTGTAA19014778TTCATTGACAACATTATAAAACTGATTCACTATATGCCTATATAC
Pangasianodon hypophthalmus strain Indonesia chromosome 5, GENO_Phyp_1.0, whole genome shotgun sequence.
taxonomy:"310915", bioproject:"PRJNA630732", refseq:"NC_047599.1"
NC_047599.1:4027604-4027618
TCACTTTATTATTCACATCTGCAGTAGCAT4027604TTCATTGACAACATTTCTTGGATCACTCAGCTTTTCCTTTTTGTT
Pangasianodon hypophthalmus strain Indonesia chromosome 5, GENO_Phyp_1.0, whole genome shotgun sequence.
taxonomy:"310915", bioproject:"PRJNA630732", refseq:"NC_047599.1"
NC_047599.1:16994324-16994338
AAGTGCAATGATATTTTAGCTGGTTCAGAG16994324TTCATTGACAACATTATACATCCCTGTACAATCCCAAACAATTTC
Trachemys scripta elegans isolate TJP31775 chromosome 1, CAS_Tse_1.0, whole genome shotgun sequence.
taxonomy:"31138", bioproject:"PRJNA634151", refseq:"NC_048298.1"
NC_048298.1:45842633-45842647
CATGAGAACTGAGCACATGGCTGAAGCTAA45842633TTCATTGACAACATTGAGACTACCCCTGGAAAAGTTTTGCAGTAT
Trachemys scripta elegans isolate TJP31775 chromosome 1, CAS_Tse_1.0, whole genome shotgun sequence.
taxonomy:"31138", bioproject:"PRJNA634151", refseq:"NC_048298.1"
NC_048298.1:265915689-265915703
ACTGACAGCCTCGGAGGATTACGGCCTCTG265915689TTCATTGACAACATTAGTACAGTACTACCAGTGAAGGTATATGAA
Trachemys scripta elegans isolate TJP31775 chromosome 5, CAS_Tse_1.0, whole genome shotgun sequence.
taxonomy:"31138", bioproject:"PRJNA634151", refseq:"NC_048302.1"
NC_048302.1:83225926-83225940
CAAGCAGAGCAAAACAATGTCGATAATATT83225926TTCATTGACAACATTAACATATAAAAATTCACGTGTAATTCCCCC
Trachemys scripta elegans isolate TJP31775 chromosome 5, CAS_Tse_1.0, whole genome shotgun sequence.
taxonomy:"31138", bioproject:"PRJNA634151", refseq:"NC_048302.1"
NC_048302.1:86038759-86038773
ACTTGTCTATGTAACCTTTAAAAATCTTCC86038759TTCATTGACAACATTCTCATTTGATCTTATCTGTTTCAAGACTGG
Capsicum annuum cultivar Zunla-1 chromosome 11, Pepper Zunla 1 Ref_v1.0, whole genome shotgun sequence.
taxonomy:"4072", bioproject:"PRJNA319678", refseq:"NC_029987.1"
NC_029987.1:22461440-22461454
AAGAAATACTTGGATATGTTCATCATAGTC22461440TTCATTGACAACATTCTTGTCTACTCCCACAGTGAACATGATCAT
Capsicum annuum cultivar Zunla-1 chromosome 11, Pepper Zunla 1 Ref_v1.0, whole genome shotgun sequence.
taxonomy:"4072", bioproject:"PRJNA319678", refseq:"NC_029987.1"
NC_029987.1:76235812-76235826
TCTTACATAGTTATCCTAACACCAAACATA76235812TTCATTGACAACATTGCCCCTCACTTAAGAAGCTGAAAAGTCACT
Capsicum annuum cultivar Zunla-1 chromosome 12, Pepper Zunla 1 Ref_v1.0, whole genome shotgun sequence.
taxonomy:"4072", bioproject:"PRJNA319678", refseq:"NC_029988.1"
NC_029988.1:72809403-72809417
AGGTCTTATTTGGATTCCTTTATTATTGTG72809403TTCATTGACAACATTGCTTTGTATTTGAGGAGTGGAGAGAAGTAT
Solanum lycopersicum cultivar Heinz 1706 chromosome 2, SL3.0, whole genome shotgun sequence.
taxonomy:"4081", bioproject:"PRJNA66163", refseq:"NC_015439.3"
NC_015439.3:4645266-4645280
CAAAGTTACCTAGATTAATTTGTCATTGTC4645266TTCATTGACAACATTTTGGTATATTAGAAAAATAAGGGAGATCAC
Solanum lycopersicum cultivar Heinz 1706 chromosome 4, SL3.0, whole genome shotgun sequence.
taxonomy:"4081", bioproject:"PRJNA66163", refseq:"NC_015441.3"
NC_015441.3:8489162-8489176
CACGAACTATATTCAACATTTTAGTCAAAA8489162TTCATTGACAACATTATATATGTACAAAATTTGTATAAAATTATT
Solanum lycopersicum cultivar Heinz 1706 chromosome 5, SL3.0, whole genome shotgun sequence.
taxonomy:"4081", bioproject:"PRJNA66163", refseq:"NC_015442.3"
NC_015442.3:61833200-61833214
AAGACAACGTGACAAAATTGAAATTTCTAG61833200TTCATTGACAACATTTTAATTAATAACAATTCAATCAATTTTATG
Solanum lycopersicum cultivar Heinz 1706 chromosome 5, SL3.0, whole genome shotgun sequence.
taxonomy:"4081", bioproject:"PRJNA66163", refseq:"NC_015442.3"
NC_015442.3:64021937-64021951
CAGAATTCAATGAAAGTCGCGAACATACAC64021937TTCATTGACAACATTTTATTGGGCCAGGGTCCAATATTGAGCAAA
Solanum lycopersicum cultivar Heinz 1706 chromosome 7, SL3.0, whole genome shotgun sequence.
taxonomy:"4081", bioproject:"PRJNA66163", refseq:"NC_015444.3"
NC_015444.3:67920697-67920711
TAATCACAATGGAAGCAAGAATGACAAGTT67920697TTCATTGACAACATTATCCATCACCTGTGACCTATAGCTCATGGG
Solanum lycopersicum cultivar Heinz 1706 chromosome 8, SL3.0, whole genome shotgun sequence.
taxonomy:"4081", bioproject:"PRJNA66163", refseq:"NC_015445.3"
NC_015445.3:52364833-52364847
CAACGTAACTTAGAAGCTTTCCTCAAATAC52364833TTCATTGACAACATTTTCAATCATATCAATTAAAATATAAGTTTT
Solanum lycopersicum cultivar Heinz 1706 chromosome 10, SL3.0, whole genome shotgun sequence.
taxonomy:"4081", bioproject:"PRJNA66163", refseq:"NC_015447.3"
NC_015447.3:26532383-26532397
AGAAGTTACCTAAATTCATTTGTCATTGTC26532383TTCATTGACAACATTTTGGTATATTCAAAAAATGTGGGTGAACAC
Solanum lycopersicum cultivar Heinz 1706 chromosome 12, SL3.0, whole genome shotgun sequence.
taxonomy:"4081", bioproject:"PRJNA66163", refseq:"NC_015449.3"
NC_015449.3:66410890-66410904
AACAAAATAATTGACTCTAAGCTAAAATAA66410890TTCATTGACAACATTTTCTTGCCATGTCCTTGTGTAAATGATCTC
Periophthalmus magnuspinnatus isolate fPerMag1 chromosome 4, fPerMag1.pri, whole genome shotgun sequence.
taxonomy:"409849", bioproject:"PRJNA627707", refseq:"NC_047129.1"
NC_047129.1:31993311-31993325
GATGTCACGTCTTTGGAAGCTTCTGATTGG31993311TTCATTGACAACATTTGAGTTAATTAGAGACAAACCTGTGGATGT
Periophthalmus magnuspinnatus isolate fPerMag1 chromosome 7, fPerMag1.pri, whole genome shotgun sequence.
taxonomy:"409849", bioproject:"PRJNA627707", refseq:"NC_047132.1"
NC_047132.1:29341582-29341596
GATGTCATGTCTTTGGAAGCTTCTGATTGG29341582TTCATTGACAACATTTGAGTTAAATAGAGAGACACCCATGGATGT
Periophthalmus magnuspinnatus isolate fPerMag1 chromosome 13, fPerMag1.pri, whole genome shotgun sequence.
taxonomy:"409849", bioproject:"PRJNA627707", refseq:"NC_047138.1"
NC_047138.1:13154600-13154614
GAGGTGACCCCACTCATACTAAGAATGCAG13154600TTCATTGACAACATTCCAGACAAAGCATTAACAACTCCGTGAGAA
Periophthalmus magnuspinnatus isolate fPerMag1 chromosome 13, fPerMag1.pri, whole genome shotgun sequence.
taxonomy:"409849", bioproject:"PRJNA627707", refseq:"NC_047138.1"
NC_047138.1:13192372-13192386
GAGGTGACCCCACTCATACTAAGAATGCAG13192372TTCATTGACAACATTCCAGACAAAGCATTAACAACTCCGTGAGAA
Periophthalmus magnuspinnatus isolate fPerMag1 chromosome 16, fPerMag1.pri, whole genome shotgun sequence.
taxonomy:"409849", bioproject:"PRJNA627707", refseq:"NC_047141.1"
NC_047141.1:20939043-20939057
GATGTAATGTCTTTGGAAACATCTGATAGG20939043TTCATTGACAACATTTGATTAATCAGAGACCCATCTGTGGATGTA
Periophthalmus magnuspinnatus isolate fPerMag1 chromosome 20, fPerMag1.pri, whole genome shotgun sequence.
taxonomy:"409849", bioproject:"PRJNA627707", refseq:"NC_047145.1"
NC_047145.1:15437530-15437544
TTTGTATCTTCAAAAGTTACATAAGTAGTT15437530TTCATTGACAACATTTGTCTATTAGCATTATGTTGCTATTAACCG
Periophthalmus magnuspinnatus isolate fPerMag1 chromosome 21, fPerMag1.pri, whole genome shotgun sequence.
taxonomy:"409849", bioproject:"PRJNA627707", refseq:"NC_047146.1"
NC_047146.1:12057023-12057037
CGTGATCAGGAAGGGCAAGATGTACTTCTC12057023TTCATTGACAACATTTTCAGATTCACTCAGGCGGGCTCTGAGGTT
Etheostoma cragini isolate CJK2018 chromosome 2, CSU_Ecrag_1.0, whole genome shotgun sequence.
taxonomy:"417921", bioproject:"PRJNA635957", refseq:"NC_048408.1"
NC_048408.1:3897071-3897085
AAATGTCGAATCGTAAAAGCTAAATCCAGT3897071TTCATTGACAACATTGCTATATTCACTTTACCATATTCCAGTGGT
Etheostoma cragini isolate CJK2018 chromosome 2, CSU_Ecrag_1.0, whole genome shotgun sequence.
taxonomy:"417921", bioproject:"PRJNA635957", refseq:"NC_048408.1"
NC_048408.1:4599238-4599252
TTAAAAAAAAACATGTTTGTCATTCTAATG4599238TTCATTGACAACATTTACAAGTTGGCTCAGCCTGACACCCCAGCA
Etheostoma cragini isolate CJK2018 chromosome 10, CSU_Ecrag_1.0, whole genome shotgun sequence.
taxonomy:"417921", bioproject:"PRJNA635957", refseq:"NC_048416.1"
NC_048416.1:3610277-3610291
ATAATTGATCATTTCATGACATATAATACT3610277TTCATTGACAACATTAATTAGTATAGTTATAAGAAACTAGTTGAG
Sesamum indicum cultivar Zhongzhi No. 13 linkage group LG8, S_indicum_v1.0, whole genome shotgun sequence.
taxonomy:"4182", bioproject:"PRJNA268358", refseq:"NC_026152.1"
NC_026152.1:18312293-18312307
ATCGCAATTATGCACTACATCAACATCACC18312293TTCATTGACAACATTATTTTTCTGGATGGTTGTGTGAAAAACACC
Bathycoccus prasinos genomic : Chromosome_14.
taxonomy:"41875", bioproject:"PRJNA394752", refseq:"NC_023995.1"
NC_023995.1:363866-363880
TCCAAATTTCTAAAAAATATATTAATGGAT363866TTCATTGACAACATTGAGAAGTCAAGGCACGTTTCAAGACAACTT
Camelus ferus isolate YT-003-E chromosome 2, BCGSAC_Cfer_1.0, whole genome shotgun sequence.
taxonomy:"419612", bioproject:"PRJNA605179", refseq:"NC_045697.1"
NC_045697.1:105762740-105762754
CTAGAATATATTATCACTTAGACACAGATT105762740TTCATTGACAACATTCTGTGGGCATCCACTTAATATTAAGCCAAG
Camelus ferus isolate YT-003-E chromosome 3, BCGSAC_Cfer_1.0, whole genome shotgun sequence.
taxonomy:"419612", bioproject:"PRJNA605179", refseq:"NC_045698.1"
NC_045698.1:56579346-56579360
TTAAGTGCTATTAAAGCATGTATGTCTTAG56579346TTCATTGACAACATTGTTTTTTCTTCTTCCTAATTGGTATAAAAT
Camelus ferus isolate YT-003-E chromosome 3, BCGSAC_Cfer_1.0, whole genome shotgun sequence.
taxonomy:"419612", bioproject:"PRJNA605179", refseq:"NC_045698.1"
NC_045698.1:65324649-65324663
GAAACAAAGGTTAGAGTTTAAGGAAATTAT65324649TTCATTGACAACATTAAATATTTACAAAATTTCAACTTTATCTCA
Camelus ferus isolate YT-003-E chromosome 7, BCGSAC_Cfer_1.0, whole genome shotgun sequence.
taxonomy:"419612", bioproject:"PRJNA605179", refseq:"NC_045702.1"
NC_045702.1:7768644-7768658
GACAGTTTGCAGTTCTTGGTTGTTAACTGA7768644TTCATTGACAACATTTGCAGCTTAAGATCTCCAAGTGATTCAGCT
Camelus ferus isolate YT-003-E chromosome 10, BCGSAC_Cfer_1.0, whole genome shotgun sequence.
taxonomy:"419612", bioproject:"PRJNA605179", refseq:"NC_045705.1"
NC_045705.1:67811324-67811338
TGACCCTTTTTTATGTTGTAATAACTCTTT67811324TTCATTGACAACATTCCTTTCTCTGAAGTCTCTGTCTGAAATTAA
Camelus ferus isolate YT-003-E chromosome 14, BCGSAC_Cfer_1.0, whole genome shotgun sequence.
taxonomy:"419612", bioproject:"PRJNA605179", refseq:"NC_045709.1"
NC_045709.1:41493269-41493283
GGCTCCACCAGTTACTAACTTCCTGCTTTC41493269TTCATTGACAACATTAGAATAATAATATCTATTCACCTGATTTTA
Camelus ferus isolate YT-003-E chromosome 16, BCGSAC_Cfer_1.0, whole genome shotgun sequence.
taxonomy:"419612", bioproject:"PRJNA605179", refseq:"NC_045711.1"
NC_045711.1:13643555-13643569
CTTTTAGGACACAAAGGTGAGGCTTTCTGT13643555TTCATTGACAACATTGCATTGAAATGACTCTGACAGACACAGGAT
Camelus ferus isolate YT-003-E chromosome 17, BCGSAC_Cfer_1.0, whole genome shotgun sequence.
taxonomy:"419612", bioproject:"PRJNA605179", refseq:"NC_045712.1"
NC_045712.1:19738081-19738095
AGTATGCTGCACTCCAAATTCTATTGTGTT19738081TTCATTGACAACATTCACTATTACATATGCATATGAAAAACAGGC
Phocoena sinus isolate mPhoSin1 chromosome 2, mPhoSin1.pri, whole genome shotgun sequence.
taxonomy:"42100", bioproject:"PRJNA606521", refseq:"NC_045764.1"
NC_045764.1:150055858-150055872
AAATAATGTATCTTATAATATTCTAAGATA150055858TTCATTGACAACATTTTTAAATGCTCATAATTTTGCACTGATCTC
Phocoena sinus isolate mPhoSin1 chromosome 3, mPhoSin1.pri, whole genome shotgun sequence.
taxonomy:"42100", bioproject:"PRJNA606521", refseq:"NC_045765.1"
NC_045765.1:43113622-43113636
TTTTATTTTTTAAATAATGGACTCCACACA43113622TTCATTGACAACATTGAAAAATCTCTCACATTCCCTCCACACACC
Phocoena sinus isolate mPhoSin1 chromosome 3, mPhoSin1.pri, whole genome shotgun sequence.
taxonomy:"42100", bioproject:"PRJNA606521", refseq:"NC_045765.1"
NC_045765.1:89184036-89184050
CATGATAACAATCTGAGTCATGTAGTTGAG89184036TTCATTGACAACATTTAAATAATCCATAGCTCGTTTCCACTGTTC
Phocoena sinus isolate mPhoSin1 chromosome 11, mPhoSin1.pri, whole genome shotgun sequence.
taxonomy:"42100", bioproject:"PRJNA606521", refseq:"NC_045773.1"
NC_045773.1:32085495-32085509
AGTATGCTGCACTCCAGATACTATTGTGTT32085495TTCATTGACAACATTCACTATTACATATGCATGTGAAAAACAGGC
Phocoena sinus isolate mPhoSin1 chromosome 14, mPhoSin1.pri, whole genome shotgun sequence.
taxonomy:"42100", bioproject:"PRJNA606521", refseq:"NC_045776.1"
NC_045776.1:9696681-9696695
GCAAAGAATCCATGCTTAAAATATAACAAT9696681TTCATTGACAACATTTAAAATTTTTGTCTTAAAATTTAATACCAA
Phocoena sinus isolate mPhoSin1 chromosome 16, mPhoSin1.pri, whole genome shotgun sequence.
taxonomy:"42100", bioproject:"PRJNA606521", refseq:"NC_045778.1"
NC_045778.1:12348019-12348033
AAATAATGTATCTTATAATATTCTAAGATA12348019TTCATTGACAACATTTTTAAATGCTCATATTTTTGCACTGATCTC
Phocoena sinus isolate mPhoSin1 chromosome 16, mPhoSin1.pri, whole genome shotgun sequence.
taxonomy:"42100", bioproject:"PRJNA606521", refseq:"NC_045778.1"
NC_045778.1:32571534-32571548
CTTCTTATGACTATGGAAGTTTATTTTATA32571534TTCATTGACAACATTTTGGAAATTATACATTCTTTTAAACTTTAA
Phocoena sinus isolate mPhoSin1 chromosome 18, mPhoSin1.pri, whole genome shotgun sequence.
taxonomy:"42100", bioproject:"PRJNA606521", refseq:"NC_045780.1"
NC_045780.1:46438627-46438641
AAGTTGTGATAACACACTTCAACCCCAACG46438627TTCATTGACAACATTACTTCATTGCCGTTCCTATCAAATTTTTCC
Phocoena sinus isolate mPhoSin1 chromosome 21, mPhoSin1.pri, whole genome shotgun sequence.
taxonomy:"42100", bioproject:"PRJNA606521", refseq:"NC_045783.1"
NC_045783.1:8646777-8646791
TCTAACTAGTTACGATCATGAATGGCTATT8646777TTCATTGACAACATTCTGTGATTTCCCAGTATATCTGATTCAAGA
Phocoena sinus isolate mPhoSin1 chromosome X, mPhoSin1.pri, whole genome shotgun sequence.
taxonomy:"42100", bioproject:"PRJNA606521", refseq:"NC_045784.1"
NC_045784.1:74145610-74145624
TTGTTTAGTCTTATAAAACTAGATTGCTAT74145610TTCATTGACAACATTGTCAAAAGTGAATGAAGACTGACACCATAA
Helianthus annuus cultivar XRQ/B chromosome 1, HanXRQr2.0-SUNRISE, whole genome shotgun sequence.
taxonomy:"4232", bioproject:"PRJNA396063", refseq:"NC_035433.2"
NC_035433.2:32680648-32680662
AGCCTTCTATGTTCTTCATTGTTAATGGCG32680648TTCATTGACAACATTCTTGGGGATGGCAAACTGATTTCTGCAGGT
Helianthus annuus cultivar XRQ/B chromosome 1, HanXRQr2.0-SUNRISE, whole genome shotgun sequence.
taxonomy:"4232", bioproject:"PRJNA396063", refseq:"NC_035433.2"
NC_035433.2:107738734-107738748
TGCATTAGTTGCATGTCTTCAAGTCGGTTT107738734TTCATTGACAACATTGTTGTCAGGTTTGTTTCGTAATATTACTAT
Helianthus annuus cultivar XRQ/B chromosome 2, HanXRQr2.0-SUNRISE, whole genome shotgun sequence.
taxonomy:"4232", bioproject:"PRJNA396063", refseq:"NC_035434.2"
NC_035434.2:151131010-151131024
AAGCCGTACTTAGACAAATTCGTCATCGTT151131010TTCATTGACAACATTCTTATCTACTCGAAGAACCGAGCTGACCAT
Helianthus annuus cultivar XRQ/B chromosome 3, HanXRQr2.0-SUNRISE, whole genome shotgun sequence.
taxonomy:"4232", bioproject:"PRJNA396063", refseq:"NC_035435.2"
NC_035435.2:97033680-97033694
TTGTAAAGAAGCTGCCGAAACCACAGGAGG97033680TTCATTGACAACATTCCTACCAACTAATTATACATATTATACATA
Helianthus annuus cultivar XRQ/B chromosome 4, HanXRQr2.0-SUNRISE, whole genome shotgun sequence.
taxonomy:"4232", bioproject:"PRJNA396063", refseq:"NC_035436.2"
NC_035436.2:16039929-16039943
AAACCTTACTTGGATAAATTCGTCATAGTC16039929TTCATTGACAACATTCTCATTTATTCCAAGAGTAAAGCTGATCAC
Helianthus annuus cultivar XRQ/B chromosome 4, HanXRQr2.0-SUNRISE, whole genome shotgun sequence.
taxonomy:"4232", bioproject:"PRJNA396063", refseq:"NC_035436.2"
NC_035436.2:99417655-99417669
AAACCCTATCTTGACAAGTTCGTCATTGTC99417655TTCATTGACAACATTCTGATCTACTCCAAGAGTCAGGAAGAACAC
Helianthus annuus cultivar XRQ/B chromosome 7, HanXRQr2.0-SUNRISE, whole genome shotgun sequence.
taxonomy:"4232", bioproject:"PRJNA396063", refseq:"NC_035439.2"
NC_035439.2:30837029-30837043
AAACCATACTTGGACAAATTTGTTATCGTC30837029TTCATTGACAACATTCTGATTTATTCGAAGAATCAAGCTGAACAC
Helianthus annuus cultivar XRQ/B chromosome 7, HanXRQr2.0-SUNRISE, whole genome shotgun sequence.
taxonomy:"4232", bioproject:"PRJNA396063", refseq:"NC_035439.2"
NC_035439.2:58040018-58040032
AAGCCGTATCTCGACAAATTCGTCATAGTG58040018TTCATTGACAACATTTTGATATACTCACGATCAGCAGCTGAGCAT
Helianthus annuus cultivar XRQ/B chromosome 9, HanXRQr2.0-SUNRISE, whole genome shotgun sequence.
taxonomy:"4232", bioproject:"PRJNA396063", refseq:"NC_035441.2"
NC_035441.2:92298491-92298505
AAACCCTATCTAGACAAGTTTGTGATTGTA92298491TTCATTGACAACATTCTGATCTACTCCAAGAGTCAGGAGGAACAC
Taeniopygia guttata isolate Blue55 chromosome 1A, bTaeGut1.4.pri, whole genome shotgun sequence.
taxonomy:"59729", bioproject:"PRJNA558048", refseq:"NC_044212.2"
NC_044212.2:32502254-32502268
TTCTGCAGTGAAGCTTATTCTGTTAAGTGT32502254TTCATTGACAACATTTGAACTAGCTAAAACAACAGCATGACCCCC
Taeniopygia guttata isolate Blue55 chromosome 1A, bTaeGut1.4.pri, whole genome shotgun sequence.
taxonomy:"59729", bioproject:"PRJNA558048", refseq:"NC_044212.2"
NC_044212.2:35790484-35790498
AAACAGAACTGAAGGATTAAACCTTTGTCA35790484TTCATTGACAACATTTGTTTCTGGGTTGTCAGGTGTTCACATTGG
Taeniopygia guttata isolate Blue55 chromosome 2, bTaeGut1.4.pri, whole genome shotgun sequence.
taxonomy:"59729", bioproject:"PRJNA558048", refseq:"NC_044213.2"
NC_044213.2:72746928-72746942
TCATAGGCTATGGCTAATAGGACTCCCTGA72746928TTCATTGACAACATTAATATTCCAGTGTCCTGAAATATAGAAGAT
Taeniopygia guttata isolate Blue55 chromosome 3, bTaeGut1.4.pri, whole genome shotgun sequence.
taxonomy:"59729", bioproject:"PRJNA558048", refseq:"NC_044214.2"
NC_044214.2:18539920-18539934
TGTTGTCATTTAATTGTCTTCAGGAGCCGT18539920TTCATTGACAACATTTGTAGATACATAAAGGTCACAAGTCTGCTA
Taeniopygia guttata isolate Blue55 chromosome 4A, bTaeGut1.4.pri, whole genome shotgun sequence.
taxonomy:"59729", bioproject:"PRJNA558048", refseq:"NC_044216.2"
NC_044216.2:4847044-4847058
CTACAGAGAGGTATTTCACTGGCTTCAGTT4847044TTCATTGACAACATTTAAATTTTGCTTAAGAATTATTTTTTTTTA
Taeniopygia guttata isolate Blue55 chromosome Z, bTaeGut1.4.pri, whole genome shotgun sequence.
taxonomy:"59729", bioproject:"PRJNA558048", refseq:"NC_044241.2"
NC_044241.2:17965401-17965415
CTCACTGCTGATGAAGGACTTGCTTTACAG17965401TTCATTGACAACATTTCTATCAGGCAGTTCTTGCTTTTACAAATG
Coregonus clupeaformis isolate EN_2021a chromosome 1, ASM2061545v1, whole genome shotgun sequence.
taxonomy:"59861", bioproject:"PRJNA780548", refseq:"NC_059192.1"
NC_059192.1:62179908-62179922
AAATCAGCCGTTTCCAGCTACAATAGCCAT62179908TTCATTGACAACATTAACAATGTCTACACTGTATTTCGGATCAAT
Coregonus clupeaformis isolate EN_2021a chromosome 5, ASM2061545v1, whole genome shotgun sequence.
taxonomy:"59861", bioproject:"PRJNA780548", refseq:"NC_059196.1"
NC_059196.1:5229157-5229171
AGAAGTTATTTTTGTTTCTTTTTGACCATT5229157TTCATTGACAACATTCACAGTAAGGTACTTAATTGTTACCCAGTA
Coregonus clupeaformis isolate EN_2021a chromosome 9, ASM2061545v1, whole genome shotgun sequence.
taxonomy:"59861", bioproject:"PRJNA780548", refseq:"NC_059200.1"
NC_059200.1:7616695-7616709
AAACTAACTGAAACCATTCAGGTGGGGAGA7616695TTCATTGACAACATTGATTTAGATCAAGTTACTTGTGTGCTCTAA
Coregonus clupeaformis isolate EN_2021a chromosome 10, ASM2061545v1, whole genome shotgun sequence.
taxonomy:"59861", bioproject:"PRJNA780548", refseq:"NC_059201.1"
NC_059201.1:4779526-4779540
CTGCTAAATGACTTAAATGTAAGAAGCTGC4779526TTCATTGACAACATTTTGAACCAAAAATGGATCTTCCTCAGGTCG
Coregonus clupeaformis isolate EN_2021a chromosome 16, ASM2061545v1, whole genome shotgun sequence.
taxonomy:"59861", bioproject:"PRJNA780548", refseq:"NC_059207.1"
NC_059207.1:54126683-54126697
CTCTGCTGTATGTGTAAAAGTAAGCCACTC54126683TTCATTGACAACATTGAGCCCCATATAAAAGCATGCTATAGAATC
Coregonus clupeaformis isolate EN_2021a chromosome 26, ASM2061545v1, whole genome shotgun sequence.
taxonomy:"59861", bioproject:"PRJNA780548", refseq:"NC_059217.1"
NC_059217.1:34513521-34513535
TGTAGCAATAGTAGCCTACTTTGACAACAA34513521TTCATTGACAACATTTTCTGCCTGTGCGTCCAACATTGTAATATC
Coregonus clupeaformis isolate EN_2021a chromosome 33, ASM2061545v1, whole genome shotgun sequence.
taxonomy:"59861", bioproject:"PRJNA780548", refseq:"NC_059224.1"
NC_059224.1:1354400-1354414
TAATAACTCAGCTAGTGTTGACAGCTCTTG1354400TTCATTGACAACATTGTACGCTGAGAGCATAAGAAGCATTTAAGA
Coregonus clupeaformis isolate EN_2021a chromosome 38, ASM2061545v1, whole genome shotgun sequence.
taxonomy:"59861", bioproject:"PRJNA780548", refseq:"NC_059229.1"
NC_059229.1:6614469-6614483
TATTTTTAAATGTATTTTCTATTGACAAGC6614469TTCATTGACAACATTCTAAATGGATATCATATCTGTATGAATTGG
Coregonus clupeaformis isolate EN_2021a chromosome 38, ASM2061545v1, whole genome shotgun sequence.
taxonomy:"59861", bioproject:"PRJNA780548", refseq:"NC_059229.1"
NC_059229.1:6647382-6647396
TATTTTTAAATGTATTTTCTATTGACAAGC6647382TTCATTGACAACATTCTAAATGGATATCATATCTGTATGAATTGG
Coregonus clupeaformis isolate EN_2021a chromosome 38, ASM2061545v1, whole genome shotgun sequence.
taxonomy:"59861", bioproject:"PRJNA780548", refseq:"NC_059229.1"
NC_059229.1:6674434-6674448
ATTTTTAAATGTATTTTTTTATTGACAAGC6674434TTCATTGACAACATTCTAAATGGATATCATATCTGTATGAATTGA
Coregonus clupeaformis isolate EN_2021a chromosome 38, ASM2061545v1, whole genome shotgun sequence.
taxonomy:"59861", bioproject:"PRJNA780548", refseq:"NC_059229.1"
NC_059229.1:6711130-6711144
TATTTTTAAATGTATTTTTTATTGACAAGC6711130TTCATTGACAACATTCAAAATTGATATAATATCTGTATGAATTGA
Ficedula albicollis isolate OC2 chromosome 2, FicAlb1.5, whole genome shotgun sequence.
taxonomy:"59894", bioproject:"PRJNA208061", refseq:"NC_021673.1"
NC_021673.1:55339223-55339237
AAAAAGTATAATATTCAGGAAAGCTGAAAC55339223TTCATTGACAACATTTCTGAGATTTCTCTCCACATGCTTTAAATA
Ficedula albicollis isolate OC2 chromosome 2, FicAlb1.5, whole genome shotgun sequence.
taxonomy:"59894", bioproject:"PRJNA208061", refseq:"NC_021673.1"
NC_021673.1:148619032-148619046
CCTAAAAAATCCTCCTCCTATAGTAGATTT148619032TTCATTGACAACATTGAGATAACCACAGTCTTTTTCCATTGTCAA
Ficedula albicollis isolate OC2 chromosome 3, FicAlb1.5, whole genome shotgun sequence.
taxonomy:"59894", bioproject:"PRJNA208061", refseq:"NC_021674.1"
NC_021674.1:20253343-20253357
GAAAACAGAGCTCTTCATTTTGCAAGGTGT20253343TTCATTGACAACATTTCTGCAGGCTGGAATAGTAACAGAAGGAAT
Ficedula albicollis isolate OC2 chromosome 3, FicAlb1.5, whole genome shotgun sequence.
taxonomy:"59894", bioproject:"PRJNA208061", refseq:"NC_021674.1"
NC_021674.1:105466047-105466061
GTTTTCATTACAGCAAACTCAGTTAAAAAT105466047TTCATTGACAACATTTATACATGGGCAGTCATTGCAGTGCCAAGA
Cynara cardunculus var. scolymus isolate 2C chromosome LG 2, CcrdV1, whole genome shotgun sequence.
taxonomy:"59895", bioproject:"PRJNA453787", refseq:"NC_037529.1"
NC_037529.1:10780921-10780935
GTCCTGCCATGTGCATCCCATGTGTCATTG10780921TTCATTGACAACATTTTCACTAAAACCTACCTAACCATCATCATT
Cynara cardunculus var. scolymus isolate 2C chromosome LG 2, CcrdV1, whole genome shotgun sequence.
taxonomy:"59895", bioproject:"PRJNA453787", refseq:"NC_037529.1"
NC_037529.1:33345033-33345047
AGAATCCCAAACCAATTTTTTTTACTTGTG33345033TTCATTGACAACATTTAGGCTCTAAATAAATCATGAACACGTTAT
Cynara cardunculus var. scolymus isolate 2C chromosome LG 2, CcrdV1, whole genome shotgun sequence.
taxonomy:"59895", bioproject:"PRJNA453787", refseq:"NC_037529.1"
NC_037529.1:50978672-50978686
CGGGAATATCTTGATAAGTTTGTGATTGTA50978672TTCATTGACAACATTCTGATTTACTAGAAGACAGAGGTAGAACAT
Cynara cardunculus var. scolymus isolate 2C chromosome LG 2, CcrdV1, whole genome shotgun sequence.
taxonomy:"59895", bioproject:"PRJNA453787", refseq:"NC_037529.1"
NC_037529.1:63538742-63538756
TCTCAAACCAAAAAAAGAAATATACTTGTG63538742TTCATTGACAACATTTAGGCTCTAAATAAATCATGAACACGTTAT
Cynara cardunculus var. scolymus isolate 2C chromosome LG 13, CcrdV1, whole genome shotgun sequence.
taxonomy:"59895", bioproject:"PRJNA453787", refseq:"NC_037540.1"
NC_037540.1:29938143-29938157
CGAGAATATCTTGATAAGTTTATGATTGTG29938143TTCATTGACAACATTCTTATTTACTCAAAGACAGAGGCAGAACAT
Cynara cardunculus var. scolymus isolate 2C chromosome LG 17, CcrdV1, whole genome shotgun sequence.
taxonomy:"59895", bioproject:"PRJNA453787", refseq:"NC_037544.1"
NC_037544.1:24418953-24418967
AATCCCAAACCAAATTTTTTTTTACTTGTG24418953TTCATTGACAACATTTAGGCTCTAAATAAATCATGAACACGTTAT
Cynara cardunculus var. scolymus isolate 2C chromosome LG 17, CcrdV1, whole genome shotgun sequence.
taxonomy:"59895", bioproject:"PRJNA453787", refseq:"NC_037544.1"
NC_037544.1:29685572-29685586
TTTCAAACCAAAAAAAGAAACATACGTGTG29685572TTCATTGACAACATTTAGTCTCTAAATAAATTATCAGAACATGAT
Bactrocera tryoni isolate S06 chromosome 1, CSIRO_BtryS06_freeze2, whole genome shotgun sequence.
taxonomy:"59916", bioproject:"PRJNA695304", refseq:"NC_052499.1"
NC_052499.1:50321799-50321813
ACACATGCACATACGAATTGCTGGCGCGGG50321799TTCATTGACAACATTGGCAATGTGTCCCAGCAACAGTTGCGGTTG
Bactrocera tryoni isolate S06 chromosome 1, CSIRO_BtryS06_freeze2, whole genome shotgun sequence.
taxonomy:"59916", bioproject:"PRJNA695304", refseq:"NC_052499.1"
NC_052499.1:50999512-50999526
CTAAACGCGCTTCACGCCGCATTAAGCGAG50999512TTCATTGACAACATTTGCGCAAATTGGATATTCTCGGCGCATTAT
Bactrocera tryoni isolate S06 chromosome 4, CSIRO_BtryS06_freeze2, whole genome shotgun sequence.
taxonomy:"59916", bioproject:"PRJNA695304", refseq:"NC_052502.1"
NC_052502.1:74112620-74112634
GGATTCAAGGCAACTACCCCACAATTTTAG74112620TTCATTGACAACATTCGAGAAGCCCCTTTATATTTTCCTTGACAT
Bactrocera tryoni isolate S06 chromosome 5, CSIRO_BtryS06_freeze2, whole genome shotgun sequence.
taxonomy:"59916", bioproject:"PRJNA695304", refseq:"NC_052503.1"
NC_052503.1:58435877-58435891
TGTGATAAGTATAAAATTTAAATAAACTTG58435877TTCATTGACAACATTTTTGAAAATTGCTAGACTAAATGCCGAATA
Macadamia integrifolia cultivar HAES 741 chromosome 2, SCU_Mint_v3, whole genome shotgun sequence.
taxonomy:"60698", bioproject:"PRJNA748012", refseq:"NC_056558.1"
NC_056558.1:21619134-21619148
CGAGATGCTGAGGGACAAGATGTGCTTCTC21619134TTCATTGACAACATTTTCCGTTTCACACAAGTAAGCTTGCTTGTC
Caldicellulosiruptor obsidiansis OB47, complete sequence.
taxonomy:"608506", bioproject:"PRJNA224116", refseq:"NC_014392.1"
NC_014392.1:2291756-2291770
GCAGCAACAGAATTGCCTATTATAACATAC2291756TTCATTGACAACATTTCCCCCTTTTTAGACCTCTTTGATTTCAAG
Arvicanthis niloticus isolate mArvNil1 chromosome 1, mArvNil1.pat.X, whole genome shotgun sequence.
taxonomy:"61156", bioproject:"PRJNA632612", refseq:"NC_047658.1"
NC_047658.1:72303481-72303495
AGTAACTGACATTCAAGATGTAGTCTAGCA72303481TTCATTGACAACATTGGCTGGGAGGAGGCCATCTAGCTCTAGGCT
Arvicanthis niloticus isolate mArvNil1 chromosome 2, mArvNil1.pat.X, whole genome shotgun sequence.
taxonomy:"61156", bioproject:"PRJNA632612", refseq:"NC_047659.1"
NC_047659.1:95866716-95866730
ATAGTAATGATTTCTTCATGTTACTAGCAT95866716TTCATTGACAACATTAAAAAACAGAGCTACTGTAACTCACATGCA
Arvicanthis niloticus isolate mArvNil1 chromosome 2, mArvNil1.pat.X, whole genome shotgun sequence.
taxonomy:"61156", bioproject:"PRJNA632612", refseq:"NC_047659.1"
NC_047659.1:102226468-102226482
AAAATAGATTAACCAATGTTGTATCATGGT102226468TTCATTGACAACATTAAAAAAAAAACTATTGTTACATATTTCAAA
Arvicanthis niloticus isolate mArvNil1 chromosome 3, mArvNil1.pat.X, whole genome shotgun sequence.
taxonomy:"61156", bioproject:"PRJNA632612", refseq:"NC_047660.1"
NC_047660.1:79532003-79532017
AGTGTGCTGCACTCCAAAGAGTACTGTGTT79532003TTCATTGACAACATTCACCATTACATATGCATATGGAAAACAGGC
Arvicanthis niloticus isolate mArvNil1 chromosome 4, mArvNil1.pat.X, whole genome shotgun sequence.
taxonomy:"61156", bioproject:"PRJNA632612", refseq:"NC_047661.1"
NC_047661.1:96355426-96355440
TTTTACTGTAATTGCAAACAAGATGCATAA96355426TTCATTGACAACATTACTATTTTGTACCTTGAGTATTATTTATGT
Arvicanthis niloticus isolate mArvNil1 chromosome 4, mArvNil1.pat.X, whole genome shotgun sequence.
taxonomy:"61156", bioproject:"PRJNA632612", refseq:"NC_047661.1"
NC_047661.1:132038480-132038494
TCTGTCACAACTGGATCTGAAGTTTACACC132038480TTCATTGACAACATTGGTCTTTGTGTCTTTTATACTCACTATCTT
Arvicanthis niloticus isolate mArvNil1 chromosome 5, mArvNil1.pat.X, whole genome shotgun sequence.
taxonomy:"61156", bioproject:"PRJNA632612", refseq:"NC_047662.1"
NC_047662.1:71871962-71871976
TAATACAGGAAGAGCTGTTTCTGCTATTCT71871962TTCATTGACAACATTAGAAGCAGAACGGAGCTGTGTACTCCACTC
Arvicanthis niloticus isolate mArvNil1 chromosome 9, mArvNil1.pat.X, whole genome shotgun sequence.
taxonomy:"61156", bioproject:"PRJNA632612", refseq:"NC_047666.1"
NC_047666.1:78490513-78490527
GGTCTTCCATGGGCTTTTCTGATGTTGGTC78490513TTCATTGACAACATTGTGTCATTGGTTCCCCTTGCCTTCTTTGCT
Arvicanthis niloticus isolate mArvNil1 chromosome 17, mArvNil1.pat.X, whole genome shotgun sequence.
taxonomy:"61156", bioproject:"PRJNA632612", refseq:"NC_047674.1"
NC_047674.1:35251030-35251044
AATATTTAAATGTAGCATTTGGAAACACAG35251030TTCATTGACAACATTTTATCCAAAATGCATTTGGTTACTATTTCT
Lynx canadensis isolate LIC74 chromosome A3, mLynCan4.pri.v2, whole genome shotgun sequence.
taxonomy:"61383", bioproject:"PRJNA558991", refseq:"NC_044305.1"
NC_044305.1:69440821-69440835
TCTACAAATGCAAGCCAGAAATTAGGAAGA69440821TTCATTGACAACATTTTACTTCCATTGTGGCAACAATTTTCCTTT
Lynx canadensis isolate LIC74 chromosome B2, mLynCan4.pri.v2, whole genome shotgun sequence.
taxonomy:"61383", bioproject:"PRJNA558991", refseq:"NC_044307.1"
NC_044307.1:67539160-67539174
GTTGGGGCCAGAGTTCCATCCAGAATTAAG67539160TTCATTGACAACATTCCCCTCACCACTCACTCTTTCCCAGACTTT
Lynx canadensis isolate LIC74 chromosome C1, mLynCan4.pri.v2, whole genome shotgun sequence.
taxonomy:"61383", bioproject:"PRJNA558991", refseq:"NC_044310.1"
NC_044310.1:68252585-68252599
CAACTGAGCTAAAGGGGAGAAGGAGAGTAG68252585TTCATTGACAACATTCTCTTAATCCTAATATATTTGTTTGGGGAA
Lynx canadensis isolate LIC74 chromosome C2, mLynCan4.pri.v2, whole genome shotgun sequence.
taxonomy:"61383", bioproject:"PRJNA558991", refseq:"NC_044311.2"
NC_044311.2:7829330-7829344
TTTCACTTTCCTGGCCTTAATGGAACCATG7829330TTCATTGACAACATTTTCAAAAATCTACATCTGTGCTACGTTGTT
Lynx canadensis isolate LIC74 chromosome D2, mLynCan4.pri.v2, whole genome shotgun sequence.
taxonomy:"61383", bioproject:"PRJNA558991", refseq:"NC_044313.2"
NC_044313.2:86241931-86241945
TACAGCTAAAAAGAGAAGCCATGAGCTTGA86241931TTCATTGACAACATTGTTTTCAGAGCATGACAGTTGCAAGCCCTG
Lynx canadensis isolate LIC74 chromosome E3, mLynCan4.pri.v2, whole genome shotgun sequence.
taxonomy:"61383", bioproject:"PRJNA558991", refseq:"NC_044318.1"
NC_044318.1:11928224-11928238
TTGTGGGCTACACATTATTCTAAAAAAAAA11928224TTCATTGACAACATTTAGAAATTAAGAGTTCACATGAAAATCTGT
Rhinopithecus roxellana isolate Shanxi Qingling chromosome 2, ASM756505v1, whole genome shotgun sequence.
taxonomy:"61622", bioproject:"PRJNA565017", refseq:"NC_044550.1"
NC_044550.1:24381890-24381904
CCCCTCCAAGAGTGGTATTTTTTAATGTGG24381890TTCATTGACAACATTTTCTCTAGCAATTTTTGTTTTGTCTGGATT
Protopterus annectens isolate FY-2018-M chromosome 5.part1, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056736.1"
NC_056736.1:167676879-167676893
TTTCCTGGGATGCACCCCGTAAATACATAG167676879TTCATTGACAACATTGCTAGCATGGCTTACATTCATGCACATGTG
Protopterus annectens isolate FY-2018-M chromosome 5.part1, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056736.1"
NC_056736.1:234619430-234619444
ATTAAGTGATGAACAAATGCAGGTCTCTCC234619430TTCATTGACAACATTATAATAATTGTATTGGTTTGCCTTTATCCG
Protopterus annectens isolate FY-2018-M chromosome 5.part1, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056736.1"
NC_056736.1:306945266-306945280
TTTTACAGATATATGTTGTGCTACTTCAGG306945266TTCATTGACAACATTTTCCTCATCTGGAATGCAAGTCAGGACAAC
Protopterus annectens isolate FY-2018-M chromosome 5.part1, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056736.1"
NC_056736.1:480641717-480641731
TACATTTGCATAGATTATGCACAATTCCTT480641717TTCATTGACAACATTAATTCAGCATTAATAAATAGGGAGGGGTGG
Protopterus annectens isolate FY-2018-M chromosome 5.part1, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056736.1"
NC_056736.1:647291946-647291960
TACCATCAGCATATCAAAGTGTATCTGTAC647291946TTCATTGACAACATTTTTATTGGGTGGAAAAGAGACAGTACTAAA
Protopterus annectens isolate FY-2018-M chromosome 6.part0, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056737.1"
NC_056737.1:564929142-564929156
CAAAAGAAGGATCATGTATGGGTATTGTAA564929142TTCATTGACAACATTCTAGTACTGAATATGAGAAAATGTGTTATC
Protopterus annectens isolate FY-2018-M chromosome 6.part0, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056737.1"
NC_056737.1:1010767452-1010767466
ATTCTTCTGTGCAGCATCCAGTAAATACAG1010767452TTCATTGACAACATTAATGGCATGGGTTTGATTCTTGCAGGTGTG
Protopterus annectens isolate FY-2018-M chromosome 6.part0, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056737.1"
NC_056737.1:1465994753-1465994767
GCAGTCTTGTGCTGCCATTTTCTCCATACA1465994753TTCATTGACAACATTTTCATTCTAAGCCTCTTAGCAATTCACATG
Protopterus annectens isolate FY-2018-M chromosome 6.part0, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056737.1"
NC_056737.1:1910640297-1910640311
TTAATAACACAACCTAACCCTGATTTCAAA1910640297TTCATTGACAACATTTGCTGTCTTATGGATGTTGTTTTGAAAAAT
Protopterus annectens isolate FY-2018-M chromosome 6.part0, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056737.1"
NC_056737.1:1964348997-1964349011
TTGTCAACTATACAAGTAATTATAGAGTTC1964348997TTCATTGACAACATTCTGCAAAAAGATGGTCAAAGAGTTGGTAAT
Protopterus annectens isolate FY-2018-M chromosome 6.part1, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056738.1"
NC_056738.1:221507787-221507801
AAAAATAATTAAGTTATTGCTTAATAAACA221507787TTCATTGACAACATTTTATTATGTGGATGAACACAAGATGAATTA
Protopterus annectens isolate FY-2018-M chromosome 6.part1, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056738.1"
NC_056738.1:376795951-376795965
GCATATTATTAAGTTTAATGAGCACAAGGA376795951TTCATTGACAACATTGGTATATTTTGGTTGAGTAATGAAAACTGC
Protopterus annectens isolate FY-2018-M chromosome 7.part0, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056739.1"
NC_056739.1:295040306-295040320
TTTCCAAAAGCTTTGCTAATAATTATGTAG295040306TTCATTGACAACATTAGCCCATAATCAACTCAATAAAAATTGACA
Protopterus annectens isolate FY-2018-M chromosome 7.part0, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056739.1"
NC_056739.1:406473186-406473200
CATCCTCCTTCTTTGAGAAATGAATCATAC406473186TTCATTGACAACATTGATTGGCATGCACGTATTACAAGATAATTC
Protopterus annectens isolate FY-2018-M chromosome 7.part0, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056739.1"
NC_056739.1:420399844-420399858
TTTTGTGATAATATCTTATATTATGGTCAT420399844TTCATTGACAACATTTTTATTGTATGGGCTGGCACCACAGCAATT
Protopterus annectens isolate FY-2018-M chromosome 7.part0, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056739.1"
NC_056739.1:889762426-889762440
GCCATTAGATGTGTTCATGTAAACAGTAAG889762426TTCATTGACAACATTACTGAAATACTGGAAAAATATGTAAAGGAA
Protopterus annectens isolate FY-2018-M chromosome 7.part0, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056739.1"
NC_056739.1:1407997008-1407997022
TTTGTCAACATGCAAGTAATTATAAAGTTC1407997008TTCATTGACAACATTCTGCAAAAGATGGTCAAAGAGTTGGTAATT
Protopterus annectens isolate FY-2018-M chromosome 7.part0, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056739.1"
NC_056739.1:1502127900-1502127914
AAAATCAGTCCCGGTGCAGGGTCAGGAGTT1502127900TTCATTGACAACATTTTTCTCCCATGAAATAATGCACTCCAGCAG
Protopterus annectens isolate FY-2018-M chromosome 7.part0, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056739.1"
NC_056739.1:1558529455-1558529469
ATTAAAACTTCTCTGCCCTTGAAACTCACA1558529455TTCATTGACAACATTGAAACCCACACCACATCCAAAGAAAATGCA
Protopterus annectens isolate FY-2018-M chromosome 7.part1, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056740.1"
NC_056740.1:313785278-313785292
CATTTCCAAAGAATGAGATGCCACTTGAGG313785278TTCATTGACAACATTTTCATCATCTGGAATGGAAATGAGACCCAA
Protopterus annectens isolate FY-2018-M chromosome 7.part1, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056740.1"
NC_056740.1:319894609-319894623
CTACCTGTGATGCACCCAGTAAATACACAG319894609TTCATTGACAACATTGATGGCATGGGTTACATTCTTGCAAGTGTG
Protopterus annectens isolate FY-2018-M chromosome 7.part1, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056740.1"
NC_056740.1:535803506-535803520
AGTAGGTGTACTGTGCCATCAACATCCATT535803506TTCATTGACAACATTGTTACAATTAAGAAAGACGCAAGTAATAAA
Protopterus annectens isolate FY-2018-M chromosome 8.part0, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056741.1"
NC_056741.1:100715250-100715264
CTTTCTGTGTTGCACACAGTAAATATGGAC100715250TTCATTGACAACATTGCTGACATGGGTTCAATTGTTGCATTTGTG
Protopterus annectens isolate FY-2018-M chromosome 8.part0, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056741.1"
NC_056741.1:353074211-353074225
TTAGAAACAGCCACCAAGTTTAACTCATAC353074211TTCATTGACAACATTGTTGCCCTCACCAATGAATCCTTTCCTGAC
Protopterus annectens isolate FY-2018-M chromosome 8.part0, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056741.1"
NC_056741.1:364959334-364959348
GTGGATCTAGTTTACTTACCCAATGCTGAA364959334TTCATTGACAACATTAGATCCTCCTAACTATACATATCTGACTCT
Protopterus annectens isolate FY-2018-M chromosome 8.part0, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056741.1"
NC_056741.1:419324988-419325002
CTAGCTATAAATATTTCATTAGAGTTATAC419324988TTCATTGACAACATTTGTGCAAATGTACAGATTTTTAAAAAATTG
Protopterus annectens isolate FY-2018-M chromosome 8.part0, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056741.1"
NC_056741.1:983072497-983072511
TTCTAGAAACATTTTCCCCACAAATTTTAA983072497TTCATTGACAACATTGGTGTATTCAGATGTCTTTCTGGTCACCCT
Protopterus annectens isolate FY-2018-M chromosome 8.part0, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056741.1"
NC_056741.1:1071481005-1071481019
TGGAATGGTCCTATCGAAGAAGTTGAACTG1071481005TTCATTGACAACATTACTCAACTTACAAGTTTTTTGAAATTTACT
Protopterus annectens isolate FY-2018-M chromosome 8.part0, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056741.1"
NC_056741.1:1262799504-1262799518
CCTTTGTTTCCCCACTCGCCCACCCCTGGA1262799504TTCATTGACAACATTTGAGGGCTACTTTACTCCATGGACTATGCC
Protopterus annectens isolate FY-2018-M chromosome 8.part0, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056741.1"
NC_056741.1:1456234040-1456234054
TATGCTCCCTCTTTGAGAAATGAATCAAAC1456234040TTCATTGACAACATTGATTGACATGCAATAAATACTAGATAGTTC
Protopterus annectens isolate FY-2018-M chromosome 8.part0, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056741.1"
NC_056741.1:1465945920-1465945934
CCTCAGACACTGCTACACTCAAATGCCTTC1465945920TTCATTGACAACATTCAAAAATTAACCAAAGAAGGCAGAAGTACT
Protopterus annectens isolate FY-2018-M chromosome 8.part0, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056741.1"
NC_056741.1:1609674092-1609674106
GGGGGTATCATCTAGCTGTTCAAAGGTATT1609674092TTCATTGACAACATTGATGAATTTCTGGGCATTTCTGTTTTGGAA
Protopterus annectens isolate FY-2018-M chromosome 8.part1, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056742.1"
NC_056742.1:26236078-26236092
TATTTTGCATTGATGACATGCTACCTTAGT26236078TTCATTGACAACATTTTCATCATCCGGGAGGGGGATCAAGCTACA
Protopterus annectens isolate FY-2018-M chromosome 8.part1, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056742.1"
NC_056742.1:474891299-474891313
TGGCCAGGGACATTGCGGCCTGTCCATGCA474891299TTCATTGACAACATTACACATTATACCACCTGCTCACCTGTGTCT
Protopterus annectens isolate FY-2018-M chromosome 8.part1, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056742.1"
NC_056742.1:480550884-480550898
AACACATCAGAGCATTCTAATATAACCAAA480550884TTCATTGACAACATTTTTAATATGTCGTTTTTTTACTATTTTCAA
Protopterus annectens isolate FY-2018-M chromosome 9.part0, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056743.1"
NC_056743.1:282863741-282863755
ATGTTCCAGGAAAGGGGATACCCTGACAAA282863741TTCATTGACAACATTAGACAAGAAGTCTTGAAAGGTAGGAACACA
Protopterus annectens isolate FY-2018-M chromosome 9.part0, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056743.1"
NC_056743.1:515635267-515635281
TAGCAAACTATAGCAAATAGTGTCAATAGG515635267TTCATTGACAACATTATTATTTAGTTTACAAACCTGCTTTTAGTG
Protopterus annectens isolate FY-2018-M chromosome 9.part0, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056743.1"
NC_056743.1:567771637-567771651
ATTAAGTGATAAGCAAGTGCCAGTCACTGC567771637TTCATTGACAACATTATGAGTTCCATGGTTCCCTTTCTTTCAAAC
Protopterus annectens isolate FY-2018-M chromosome 9.part0, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056743.1"
NC_056743.1:758264386-758264400
TACCCTTATTTCTCCGACCCATCAAATATG758264386TTCATTGACAACATTCAATTGATACTATCCTCTTTGGACCACACC
Protopterus annectens isolate FY-2018-M chromosome 9.part0, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056743.1"
NC_056743.1:1254551462-1254551476
ACTATTTGCATATATTACTAGTGAAAGATT1254551462TTCATTGACAACATTTTAGTTCTAGATTATAAAGGAAACCTACTT
Protopterus annectens isolate FY-2018-M chromosome 9.part0, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056743.1"
NC_056743.1:1394115410-1394115424
ACTCCTCAAGCATCCTTTCACTTTCCAAGA1394115410TTCATTGACAACATTGATGGGATGGGTTAGATTCTTGAAAGTGTG
Protopterus annectens isolate FY-2018-M chromosome 9.part0, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056743.1"
NC_056743.1:1605796018-1605796032
AGTTCAAGGCAACACTTGAAGGGACTCATG1605796018TTCATTGACAACATTCACACAGACGATTGCCAAAGTTTGGGAGCT
Protopterus annectens isolate FY-2018-M chromosome 10.part0, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056744.1"
NC_056744.1:51191571-51191585
ATGTTCCAGGAAAGGGAATACCCTGACACA51191571TTCATTGACAACATTAGACAAGAAGTCTTGAAAGGTAGGAACACA
Protopterus annectens isolate FY-2018-M chromosome 10.part0, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056744.1"
NC_056744.1:227805157-227805171
TTTTCTATGTTGCACCCAGTAAATGCACAG227805157TTCATTGACAACATTGATTGCATGGGTTTGATTCTTGCAGCTGGT
Protopterus annectens isolate FY-2018-M chromosome 10.part0, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056744.1"
NC_056744.1:315097086-315097100
TTTAAGCAGCGTTCTCAATTTAAAAATACC315097086TTCATTGACAACATTGTTTAAAAACCAGGCATGACAAGTTTAAAA
Protopterus annectens isolate FY-2018-M chromosome 10.part0, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056744.1"
NC_056744.1:662743278-662743292
TTTTTTCTCTAATTCCAGTTTTAGAAAATT662743278TTCATTGACAACATTATTGTCTATAAGATACCTATTTATTCCATC
Protopterus annectens isolate FY-2018-M chromosome 10.part0, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056744.1"
NC_056744.1:870487400-870487414
GTTAAATATAATCACTTATTTCAGTGGAAA870487400TTCATTGACAACATTTTGATACGTGACTTATACAGTCACAAAACA
Protopterus annectens isolate FY-2018-M chromosome 10.part0, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056744.1"
NC_056744.1:1005468628-1005468642
ACTTATTTCCTCCCCACCACCACCCTTGGG1005468628TTCATTGACAACATTGGAGGGCTGCTATCCTATGTACACCTTGTG
Protopterus annectens isolate FY-2018-M chromosome 10.part0, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056744.1"
NC_056744.1:1063838322-1063838336
AGATCTCAATGGTCCTTATTGTTTTTTTCT1063838322TTCATTGACAACATTTAAATTTCTAAGGGGTTTTACCTGACAACT
Protopterus annectens isolate FY-2018-M chromosome 10.part0, PAN1.0, whole genome shotgun sequence.
taxonomy:"7888", bioproject:"PRJNA754246", refseq:"NC_056744.1"
NC_056744.1:1064517390-1064517404
CATCCTCACTCTTTGAGAAATGAATCATAG1064517390TTCATTGACAACATTGCTTATCATGCAATAAATACAAGATAATTC
Bufo bufo chromosome 4, aBufBuf1.1, whole genome shotgun sequence.
taxonomy:"8384", bioproject:"PRJNA713386", refseq:"NC_053392.1"
NC_053392.1:161533526-161533540
AGTGAATGTGGTAGTATATGTTGGTTCAGA161533526TTCATTGACAACATTTTCTGCATATGAAATGGGTCCCAAACCTCC
Bufo bufo chromosome 4, aBufBuf1.1, whole genome shotgun sequence.
taxonomy:"8384", bioproject:"PRJNA713386", refseq:"NC_053392.1"
NC_053392.1:188999065-188999079
GCTCAGGGACAGGTGTTGTCATGGATATGT188999065TTCATTGACAACATTCTGTTTGTATGGCAGTGCCCACAGAATGCT
Bufo bufo chromosome 6, aBufBuf1.1, whole genome shotgun sequence.
taxonomy:"8384", bioproject:"PRJNA713386", refseq:"NC_053394.1"
NC_053394.1:300563851-300563865
TTTAAACAACATGCTACATGTTGGTTCAGA300563851TTCATTGACAACATTTTCTGCATATGGAATAGGAACCAAACCTCC
Bufo bufo chromosome 7, aBufBuf1.1, whole genome shotgun sequence.
taxonomy:"8384", bioproject:"PRJNA713386", refseq:"NC_053395.1"
NC_053395.1:86273074-86273088
AATTTGATTACTAACATGTTATCATTGAAC86273074TTCATTGACAACATTGAGAATTTTTGGTAATGGGCCTACATTTTA
Bufo bufo chromosome 7, aBufBuf1.1, whole genome shotgun sequence.
taxonomy:"8384", bioproject:"PRJNA713386", refseq:"NC_053395.1"
NC_053395.1:106666734-106666748
TTTCAACAACATGCCATTATCTGGCTACGG106666734TTCATTGACAACATTTTCTGCCTCTGGGGAGGGTCATTATCCAGT
Rana temporaria chromosome 1, aRanTem1.1, whole genome shotgun sequence.
taxonomy:"8407", bioproject:"PRJNA714106", refseq:"NC_053489.1"
NC_053489.1:8929213-8929227
TTCTTTAGCGTCAAGTAATTTCTCATTTAA8929213TTCATTGACAACATTGGGAAAAGGATTGTAATCCAATTTTTCATA
Rana temporaria chromosome 1, aRanTem1.1, whole genome shotgun sequence.
taxonomy:"8407", bioproject:"PRJNA714106", refseq:"NC_053489.1"
NC_053489.1:29781459-29781473
CCTTTAACACTTTTCTGAATATTTATTTTT29781459TTCATTGACAACATTTCTCATTTTTAGAACAGCGTGTTTCAAATA
Rana temporaria chromosome 1, aRanTem1.1, whole genome shotgun sequence.
taxonomy:"8407", bioproject:"PRJNA714106", refseq:"NC_053489.1"
NC_053489.1:360187103-360187117
ATACTGACAACCATTGGCAATTAATTTTCA360187103TTCATTGACAACATTAAAAACTGTCTTCCCTTGACACTGCAGTTT
Rana temporaria chromosome 1, aRanTem1.1, whole genome shotgun sequence.
taxonomy:"8407", bioproject:"PRJNA714106", refseq:"NC_053489.1"
NC_053489.1:390615861-390615875
TGCATTTTTTAAATTGTATTTTCTTTCTTT390615861TTCATTGACAACATTTGACATATTGTTGCTTACTGGAGGATTTGG
Rana temporaria chromosome 1, aRanTem1.1, whole genome shotgun sequence.
taxonomy:"8407", bioproject:"PRJNA714106", refseq:"NC_053489.1"
NC_053489.1:498172713-498172727
GTGAGCATAGCAACAACTTTTTATTTTTTT498172713TTCATTGACAACATTGTTTATTTTAAATAAGTCTGTTGAGGCCAT
Rana temporaria chromosome 2, aRanTem1.1, whole genome shotgun sequence.
taxonomy:"8407", bioproject:"PRJNA714106", refseq:"NC_053490.1"
NC_053490.1:1648465-1648479
AAGTCTATGCTATGTGTTAGAAATATATCA1648465TTCATTGACAACATTGTTAAAAAACAATTACATTTCATTTTAATT
Rana temporaria chromosome 2, aRanTem1.1, whole genome shotgun sequence.
taxonomy:"8407", bioproject:"PRJNA714106", refseq:"NC_053490.1"
NC_053490.1:119505937-119505951
GTGTTCTGGTTTTTTTTTTTATTTCATCTG119505937TTCATTGACAACATTTTTCAATTACAAGTCATATAAAACAGAACA
Rana temporaria chromosome 2, aRanTem1.1, whole genome shotgun sequence.
taxonomy:"8407", bioproject:"PRJNA714106", refseq:"NC_053490.1"
NC_053490.1:129799966-129799980
AGAGATCAAGAGGGACAAGATGTGCTACTT129799966TTCATTGACAACATTTTCAGGTTTACCCAGGCTGGCTCAGAGGTG
Rana temporaria chromosome 3, aRanTem1.1, whole genome shotgun sequence.
taxonomy:"8407", bioproject:"PRJNA714106", refseq:"NC_053491.1"
NC_053491.1:243061834-243061848
TTTTTTGATCATGTTTTGATTTGGCATCGC243061834TTCATTGACAACATTTGTGTTGTATGGACTGGCAGCCTTGAAGAT
Rana temporaria chromosome 3, aRanTem1.1, whole genome shotgun sequence.
taxonomy:"8407", bioproject:"PRJNA714106", refseq:"NC_053491.1"
NC_053491.1:318301609-318301623
AAAAAACATTACCATTTTTGTTCTGTGCTC318301609TTCATTGACAACATTCCCTCCCATTCCAAGTCTTGAAAAGCATCC
Rana temporaria chromosome 5, aRanTem1.1, whole genome shotgun sequence.
taxonomy:"8407", bioproject:"PRJNA714106", refseq:"NC_053493.1"
NC_053493.1:191325626-191325640
AACAATCTGGTACAGCAAGTCCCTGAAGAT191325626TTCATTGACAACATTTTGAAACACAGCTGGGGCATTACACAACCC
Rana temporaria chromosome 5, aRanTem1.1, whole genome shotgun sequence.
taxonomy:"8407", bioproject:"PRJNA714106", refseq:"NC_053493.1"
NC_053493.1:283893294-283893308
GCCCATGGCATGTTTTGAGCAATATATCAT283893294TTCATTGACAACATTTGGTTGAGGGGGAGTAGACGCTCCAGGCAG
Rana temporaria chromosome 6, aRanTem1.1, whole genome shotgun sequence.
taxonomy:"8407", bioproject:"PRJNA714106", refseq:"NC_053494.1"
NC_053494.1:64748389-64748403
TTTTTTGATAAATTCCTTAGCTGGCATCGT64748389TTCATTGACAACATTTTTGTTGTTTGGACCGGATCCAGAGAGGAA
Rana temporaria chromosome 11, aRanTem1.1, whole genome shotgun sequence.
taxonomy:"8407", bioproject:"PRJNA714106", refseq:"NC_053499.1"
NC_053499.1:16931662-16931676
TTTATGAATTAGTAAAATATATATATTTTT16931662TTCATTGACAACATTTTTTTTATATCTTCCCCTTTACAATTCCTT
Rana temporaria chromosome 13, aRanTem1.1, whole genome shotgun sequence.
taxonomy:"8407", bioproject:"PRJNA714106", refseq:"NC_053501.1"
NC_053501.1:23877461-23877475
CATTGACACCATCGATGGGGCACAATTCCT23877461TTCATTGACAACATTGATGGGGCAAGATTCATTCCATTGACACCA
Chelonia mydas isolate rCheMyd1 chromosome 5, rCheMyd1.pri.v2, whole genome shotgun sequence.
taxonomy:"8469", bioproject:"PRJNA675851", refseq:"NC_051245.2"
NC_051245.2:34356538-34356552
ACATATGATTAGGCTTCACAAGATGTCTTA34356538TTCATTGACAACATTACTGTTTAGAGTAAAAAATTACCAAACTGT
Chelonia mydas isolate rCheMyd1 chromosome 5, rCheMyd1.pri.v2, whole genome shotgun sequence.
taxonomy:"8469", bioproject:"PRJNA675851", refseq:"NC_051245.2"
NC_051245.2:100483611-100483625
CCATATGATCAGGCTTCACAAGATGGCGTA100483611TTCATTGACAACATTACTGTTTAGAGTCATAAATTACCAAACTGT
Chelonia mydas isolate rCheMyd1 chromosome 10, rCheMyd1.pri.v2, whole genome shotgun sequence.
taxonomy:"8469", bioproject:"PRJNA675851", refseq:"NC_051250.2"
NC_051250.2:28069382-28069396
ATCCTTGGAATGAAAATCCACCAACCATTT28069382TTCATTGACAACATTCCTAACACATGCATCTTTTATGAAGCATTT
Chelonia mydas isolate rCheMyd1 chromosome 11, rCheMyd1.pri.v2, whole genome shotgun sequence.
taxonomy:"8469", bioproject:"PRJNA675851", refseq:"NC_051251.2"
NC_051251.2:34598829-34598843
AAAGCTGTAGGATTTATGGTAAACAGAGTT34598829TTCATTGACAACATTGTTGATGGATTAATTTAAAACAGGAAACTA
Chelonia mydas isolate rCheMyd1 chromosome 1, rCheMyd1.pri.v2, whole genome shotgun sequence.
taxonomy:"8469", bioproject:"PRJNA675851", refseq:"NC_057849.1"
NC_057849.1:281849861-281849875
CCATATGATCAGGCTTCTCAAGATGGCATA281849861TTCATTGACAACATTACTGTTTAGAGTAATAAATTACCAAACTGT
Chelonia mydas isolate rCheMyd1 chromosome 2, rCheMyd1.pri.v2, whole genome shotgun sequence.
taxonomy:"8469", bioproject:"PRJNA675851", refseq:"NC_057850.1"
NC_057850.1:41358977-41358991
AATCTCATCAATATTGTCTTATAATATAAT41358977TTCATTGACAACATTGGTGAGTTTAGTGACTCATATCATTGCTTA
Chelonia mydas isolate rCheMyd1 chromosome 2, rCheMyd1.pri.v2, whole genome shotgun sequence.
taxonomy:"8469", bioproject:"PRJNA675851", refseq:"NC_057850.1"
NC_057850.1:168694681-168694695
ACTACTGTCATGCTGGAGCCTCCACATTTA168694681TTCATTGACAACATTTGCAGAATTTTAAAGTATTGTGTGCAGAAT
Chelonia mydas isolate rCheMyd1 chromosome 2, rCheMyd1.pri.v2, whole genome shotgun sequence.
taxonomy:"8469", bioproject:"PRJNA675851", refseq:"NC_057850.1"
NC_057850.1:222165465-222165479
TCCTTGAAAAGAAATAGTGATCATCCTGGT222165465TTCATTGACAACATTCTCTTTGTCACGTAAGTTCTAATATCCCAG
Chelonia mydas isolate rCheMyd1 chromosome 4, rCheMyd1.pri.v2, whole genome shotgun sequence.
taxonomy:"8469", bioproject:"PRJNA675851", refseq:"NC_057852.1"
NC_057852.1:87270100-87270114
ACTTGTCAATGTCGCCTTTAAAAATCTTCC87270100TTCATTGACAACATTCTCATTTTATCTTATCTGTTTCAAGACTGG
Chelonia mydas isolate rCheMyd1 chromosome 7, rCheMyd1.pri.v2, whole genome shotgun sequence.
taxonomy:"8469", bioproject:"PRJNA675851", refseq:"NC_057853.1"
NC_057853.1:35714974-35714988
CCATATGATCAGGCTTCGCAAGATGGCATA35714974TTCATTGACAACATTAATGTTTAGAGTCATAAATTACCAAACTGT
Chelonia mydas isolate rCheMyd1 chromosome 7, rCheMyd1.pri.v2, whole genome shotgun sequence.
taxonomy:"8469", bioproject:"PRJNA675851", refseq:"NC_057853.1"
NC_057853.1:36046016-36046030
CCATATGATCAGGCTTCGCAAGATGGCATA36046016TTCATTGACAACATTACTGTTCAGAGTCATAAGTTACCAAACTGT
Chelonia mydas isolate rCheMyd1 chromosome 9, rCheMyd1.pri.v2, whole genome shotgun sequence.
taxonomy:"8469", bioproject:"PRJNA675851", refseq:"NC_057855.1"
NC_057855.1:85162046-85162060
AGCACTTCTTGAGCCAGAATTGCTTCGAAT85162046TTCATTGACAACATTGTCCCTTTACATAACCATTGCTGTGTTCAA
Chrysemys picta bellii isolate RCT428 chromosome 1, Chrysemys_picta_BioNano-3.0.4, whole genome shotgun sequence.
taxonomy:"8478", bioproject:"PRJNA210179", refseq:"NC_024218.2"
NC_024218.2:32042053-32042067
TCTCCGGCATTTGTGTCAGGGAATGGGTGC32042053TTCATTGACAACATTAATACGTTGTCATCACTGCAGCTGAACTTT
Chrysemys picta bellii isolate RCT428 chromosome 5, Chrysemys_picta_BioNano-3.0.4, whole genome shotgun sequence.
taxonomy:"8478", bioproject:"PRJNA210179", refseq:"NC_024222.2"
NC_024222.2:23384661-23384675
ATAGAAAAAGTCTTCCTAATTACATATTCC23384661TTCATTGACAACATTGTCTCCAACCGTGAAAGATGGATGAGAGTT
Chrysemys picta bellii isolate RCT428 chromosome 8, Chrysemys_picta_BioNano-3.0.4, whole genome shotgun sequence.
taxonomy:"8478", bioproject:"PRJNA210179", refseq:"NC_024225.2"
NC_024225.2:42476401-42476415
AGCACTTCTTGAGCCAGAATTGCTTGGAAT42476401TTCATTGACAACATTGTCTCTTTAAACAACCATTGCTTTGTACAG
Molothrus ater isolate BHLD 08-10-18 breed brown headed cowbird chromosome 3, BPBGC_Mater_1.0, whole genome shotgun sequence.
taxonomy:"84834", bioproject:"PRJNA665515", refseq:"NC_050480.1"
NC_050480.1:18560163-18560177
GAAAACAGAAGTCTTCATTTTGCAAGGTGT18560163TTCATTGACAACATTCCAGCAGGCTAGAATAGTAACAGCAGGAAT
Molothrus ater isolate BHLD 08-10-18 breed brown headed cowbird chromosome 6, BPBGC_Mater_1.0, whole genome shotgun sequence.
taxonomy:"84834", bioproject:"PRJNA665515", refseq:"NC_050483.1"
NC_050483.1:18653478-18653492
AGACTTTATTTATTTTTTTTAAAAGTACAT18653478TTCATTGACAACATTTTGAGCCTCTGTAGAATGCTTTTGCTGTTG
Molothrus ater isolate BHLD 08-10-18 breed brown headed cowbird chromosome 19, BPBGC_Mater_1.0, whole genome shotgun sequence.
taxonomy:"84834", bioproject:"PRJNA665515", refseq:"NC_050496.1"
NC_050496.1:130981-130995
TATGGAGGGTTATAACTGGACAAGGATAAT130981TTCATTGACAACATTATGGATGAAACACTGAAATTACTTATGAAA
Sceloporus undulatus isolate JIND9_A2432 ecotype Alabama chromosome 4, SceUnd_v1.1, whole genome shotgun sequence.
taxonomy:"8520", bioproject:"PRJNA746303", refseq:"NC_056525.1"
NC_056525.1:21164580-21164594
TTTGAAAGGCTAGACCAATGTGTTCATTCT21164580TTCATTGACAACATTTGTTAATGGGTCCCTTTTGGGAGAAAGGCA
Sceloporus undulatus isolate JIND9_A2432 ecotype Alabama chromosome 4, SceUnd_v1.1, whole genome shotgun sequence.
taxonomy:"8520", bioproject:"PRJNA746303", refseq:"NC_056525.1"
NC_056525.1:184275619-184275633
ATGACCTATCCTCCATGAATCTGTCTAATC184275619TTCATTGACAACATTCAATTAAAAATTATTACTACATCAAGTAGT
Sceloporus undulatus isolate JIND9_A2432 ecotype Alabama chromosome 5, SceUnd_v1.1, whole genome shotgun sequence.
taxonomy:"8520", bioproject:"PRJNA746303", refseq:"NC_056526.1"
NC_056526.1:99866801-99866815
AAACCCGCCCATCCATCCCCTCAGTGTCTG99866801TTCATTGACAACATTTGTTTGCGGCTCATTCGGAACTGAAGAGGG
Sceloporus undulatus isolate JIND9_A2432 ecotype Alabama chromosome 5, SceUnd_v1.1, whole genome shotgun sequence.
taxonomy:"8520", bioproject:"PRJNA746303", refseq:"NC_056526.1"
NC_056526.1:165049339-165049353
GTTCTCAGATACAATTTAACAACTGGTTTC165049339TTCATTGACAACATTGTTATTCATATTCTTCCACTGTCAATTTTT
Sceloporus undulatus isolate JIND9_A2432 ecotype Alabama chromosome 9, SceUnd_v1.1, whole genome shotgun sequence.
taxonomy:"8520", bioproject:"PRJNA746303", refseq:"NC_056530.1"
NC_056530.1:19560398-19560412
ACTAGGCTATTTGATGTAATTTGGCTCCTC19560398TTCATTGACAACATTAATCTTTTTAGCGGCCTCTCAGGTCCAAAG
Zootoca vivipara isolate ELT05324 linkage group LG1, UG_Zviv_1, whole genome shotgun sequence.
taxonomy:"8524", bioproject:"PRJNA638687", refseq:"NC_048605.1"
NC_048605.1:113736318-113736332
TGCTTTTTACTCCACGAGAGGGCAGTGCAG113736318TTCATTGACAACATTCCCCTTTCCAAAAAAATTTTCCATACTGCA
Zootoca vivipara isolate ELT05324 linkage group LG2, UG_Zviv_1, whole genome shotgun sequence.
taxonomy:"8524", bioproject:"PRJNA638687", refseq:"NC_048606.1"
NC_048606.1:11008809-11008823
AGGGACCAGGAAGGTCAAGATGTACTGCTC11008809TTCATTGACAACATTTTCCGTTTCACACAAGCTGGATCTGAGGTA
Zootoca vivipara isolate ELT05324 linkage group LG6, UG_Zviv_1, whole genome shotgun sequence.
taxonomy:"8524", bioproject:"PRJNA638687", refseq:"NC_048610.1"
NC_048610.1:51491582-51491596
CTGTGCGTCACTTTTCACATTAGTTGACAT51491582TTCATTGACAACATTAAGCCCTGCTCAGTTGACCAAAACTGGGCA
Zootoca vivipara isolate ELT05324 linkage group LG8, UG_Zviv_1, whole genome shotgun sequence.
taxonomy:"8524", bioproject:"PRJNA638687", refseq:"NC_048612.1"
NC_048612.1:62908306-62908320
ATTTTCAGTAGGCCATCTTTGTTATCAACT62908306TTCATTGACAACATTTGCATCTATATATGTTTTGAATGTGTTTTC
Triticum dicoccoides isolate Atlit2015 ecotype Zavitan chromosome 2B, WEW_v2.0, whole genome shotgun sequence.
taxonomy:"85692", bioproject:"PRJNA531190", refseq:"NC_041383.1"
NC_041383.1:593684584-593684598
AGCCATGGTCGGTGAAGTGGCGTCGTCTTC593684584TTCATTGACAACATTCGCAACAACAGTTGCAGCTGAAGATGAATA
Triticum dicoccoides isolate Atlit2015 ecotype Zavitan chromosome 3A, WEW_v2.0, whole genome shotgun sequence.
taxonomy:"85692", bioproject:"PRJNA531190", refseq:"NC_041384.1"
NC_041384.1:125844748-125844762
GAAATGATCACCCATTTTATTATACAACTT125844748TTCATTGACAACATTCATAACTAAAAAGCGTCTCTTCACTGATGT
Triticum dicoccoides isolate Atlit2015 ecotype Zavitan chromosome 3A, WEW_v2.0, whole genome shotgun sequence.
taxonomy:"85692", bioproject:"PRJNA531190", refseq:"NC_041384.1"
NC_041384.1:666886162-666886176
CCGTGTACAGTCGTCTTCCGATGGATGTCG666886162TTCATTGACAACATTGACCACGCCGTGCCGATAGCACTAAGGCGA
Papio anubis isolate 15944 chromosome 15, Panubis1.0, whole genome shotgun sequence.
taxonomy:"9555", bioproject:"PRJNA576697", refseq:"NC_044990.1"
NC_044990.1:45771509-45771523
TGTTCAACATTTTCCCCTCCAATGTATCTT45771509TTCATTGACAACATTCGGATTTATCACATCAATCAGTCAATAAAT
Papio anubis isolate 15944 chromosome 15, Panubis1.0, whole genome shotgun sequence.
taxonomy:"9555", bioproject:"PRJNA576697", refseq:"NC_044990.1"
NC_044990.1:62707700-62707714
GCAGTCTGGAGGTTCTCCCTGGAGGCTGTA62707700TTCATTGACAACATTGCCTGAGGTAACTCACACTGAGGTGACAAC
Papio anubis isolate 15944 chromosome 17, Panubis1.0, whole genome shotgun sequence.
taxonomy:"9555", bioproject:"PRJNA576697", refseq:"NC_044992.1"
NC_044992.1:13613285-13613299
GCCTCTGGGCCTATGTTAGATGGGCCATGC13613285TTCATTGACAACATTGATTTTATGTTTATTTGTGAAAGGGCAGAA
Papio anubis isolate 15944 chromosome 20, Panubis1.0, whole genome shotgun sequence.
taxonomy:"9555", bioproject:"PRJNA576697", refseq:"NC_044995.1"
NC_044995.1:15684668-15684682
GAGCCACCACGCTCTGCCTATCTTAGTTTT15684668TTCATTGACAACATTAGTATAATGTTAACAGCTCTCCTAAGGGAG
Theropithecus gelada isolate Dixy chromosome 2, Tgel_1.0, whole genome shotgun sequence.
taxonomy:"9565", bioproject:"PRJNA477372", refseq:"NC_037669.1"
NC_037669.1:82956280-82956294
ACTATGCTGCACTCCAAATACTATTGTGTT82956280TTCATTGACAACATTCCCTATTACATATGCATATGAAAACAGGCA
Theropithecus gelada isolate Dixy chromosome 5, Tgel_1.0, whole genome shotgun sequence.
taxonomy:"9565", bioproject:"PRJNA477372", refseq:"NC_037672.1"
NC_037672.1:145896823-145896837
CAGAATATATTATCGCTTTGAACACAGATT145896823TTCATTGACAACATTTTGTGGGCATCCATTTAATATTAATATTAA
Theropithecus gelada isolate Dixy chromosome 5, Tgel_1.0, whole genome shotgun sequence.
taxonomy:"9565", bioproject:"PRJNA477372", refseq:"NC_037672.1"
NC_037672.1:162781361-162781375
TAAAACCTCTGATTTTGTGTAACACTCCTT162781361TTCATTGACAACATTAAACAGCAATTAACTATTTGCTGACTACAT
Theropithecus gelada isolate Dixy chromosome 5, Tgel_1.0, whole genome shotgun sequence.
taxonomy:"9565", bioproject:"PRJNA477372", refseq:"NC_037672.1"
NC_037672.1:178380210-178380224
TTTGGACCCCCAGATCAGTCTTCATATTCT178380210TTCATTGACAACATTCATGAAGTTCTGCAGAAATTAAATAGAATT
Theropithecus gelada isolate Dixy chromosome 8, Tgel_1.0, whole genome shotgun sequence.
taxonomy:"9565", bioproject:"PRJNA477372", refseq:"NC_037676.1"
NC_037676.1:98008614-98008628
AGAGCCTAAATAAGCAATACCCAGCATAAT98008614TTCATTGACAACATTCAATCTATCAGTCTTTTGGGAAATATTTAT
Theropithecus gelada isolate Dixy chromosome 16, Tgel_1.0, whole genome shotgun sequence.
taxonomy:"9565", bioproject:"PRJNA477372", refseq:"NC_037684.1"
NC_037684.1:70444984-70444998
GCCTCTGGGCCTGTGTTAGATGGGCCATGC70444984TTCATTGACAACATTGATTTTATATTTATTTGTGAAAGGGCAGAA
Theropithecus gelada isolate Dixy chromosome 17, Tgel_1.0, whole genome shotgun sequence.
taxonomy:"9565", bioproject:"PRJNA477372", refseq:"NC_037685.1"
NC_037685.1:6559300-6559314
TGTTCAACATTTTCCCCTCCAATGTATCTT6559300TTCATTGACAACATTCGGATTTATCACATCAATCAGTCAATAAAT
Theropithecus gelada isolate Dixy chromosome 17, Tgel_1.0, whole genome shotgun sequence.
taxonomy:"9565", bioproject:"PRJNA477372", refseq:"NC_037685.1"
NC_037685.1:23429179-23429193
GCAGTCTGGAGGTTCTCCCTGGAGGCTGTA23429179TTCATTGACAACATTGCCTGAGGTAACTCACATTGAGGTGACAAC
Theropithecus gelada isolate Dixy chromosome 18, Tgel_1.0, whole genome shotgun sequence.
taxonomy:"9565", bioproject:"PRJNA477372", refseq:"NC_037686.1"
NC_037686.1:3769518-3769532
AGCTACAGCACTCTACAGTGGACACCCACA3769518TTCATTGACAACATTGTTTCTATAGGAAAACTTACTCTAATTTCA
Theropithecus gelada isolate Dixy chromosome 19, Tgel_1.0, whole genome shotgun sequence.
taxonomy:"9565", bioproject:"PRJNA477372", refseq:"NC_037687.1"
NC_037687.1:37033392-37033406
GAGCCACCACGCCCTGCCTATCTTAGCTTT37033392TTCATTGACAACATTAGTATAATGTTAACAGCTCTCCTAAGGGAG
Gorilla gorilla gorilla isolate Kamilah (stud number 0661) breed western lowland gorilla chromosome 2B, Kamilah_GGO_v0, whole genome shotgun sequence.
taxonomy:"9595", bioproject:"PRJNA564096", refseq:"NC_044604.1"
NC_044604.1:47102205-47102219
ATTGCAGCAAAGAAGCACATTTATATTCTA47102205TTCATTGACAACATTAGCATATAATGCAAATTTACTTTGGAACTT
Gorilla gorilla gorilla isolate Kamilah (stud number 0661) breed western lowland gorilla chromosome 3, Kamilah_GGO_v0, whole genome shotgun sequence.
taxonomy:"9595", bioproject:"PRJNA564096", refseq:"NC_044605.1"
NC_044605.1:10895147-10895161
TTTACTTTCAAAAGGTGGGGAGGGGAAGAA10895147TTCATTGACAACATTTAGAAATCAGGAGATTTCATGTGGAAAAAA
Gorilla gorilla gorilla isolate Kamilah (stud number 0661) breed western lowland gorilla chromosome 3, Kamilah_GGO_v0, whole genome shotgun sequence.
taxonomy:"9595", bioproject:"PRJNA564096", refseq:"NC_044605.1"
NC_044605.1:15294338-15294352
ATTGTAATAGCCAGAAATTGGAAACATATA15294338TTCATTGACAACATTTAAGATTATAATATAGTCATATAATAGTCC
Gorilla gorilla gorilla isolate Kamilah (stud number 0661) breed western lowland gorilla chromosome 3, Kamilah_GGO_v0, whole genome shotgun sequence.
taxonomy:"9595", bioproject:"PRJNA564096", refseq:"NC_044605.1"
NC_044605.1:84479807-84479821
TTGATTTTGTATATATTAAATAGTTGAAAC84479807TTCATTGACAACATTAAATTTGTTTTCTAGGCTCTATTGGGGTAA
Gorilla gorilla gorilla isolate Kamilah (stud number 0661) breed western lowland gorilla chromosome 4, Kamilah_GGO_v0, whole genome shotgun sequence.
taxonomy:"9595", bioproject:"PRJNA564096", refseq:"NC_044606.1"
NC_044606.1:16272267-16272281
AACGAAAGGCGTTTGAGGAAAGCCTGATAA16272267TTCATTGACAACATTACCATCAGCCACACCTTATCATTCCTAGCA
Gorilla gorilla gorilla isolate Kamilah (stud number 0661) breed western lowland gorilla chromosome 4, Kamilah_GGO_v0, whole genome shotgun sequence.
taxonomy:"9595", bioproject:"PRJNA564096", refseq:"NC_044606.1"
NC_044606.1:146706614-146706628
CAGAATATATTATCGCTTTAAACACAGATT146706614TTCATTGACAACATTTTGTGGGCACCCATTTAATATTAATATTAA
Gorilla gorilla gorilla isolate Kamilah (stud number 0661) breed western lowland gorilla chromosome 4, Kamilah_GGO_v0, whole genome shotgun sequence.
taxonomy:"9595", bioproject:"PRJNA564096", refseq:"NC_044606.1"
NC_044606.1:163469758-163469772
AAAAACCTCTGATTTTGTGTAACACTTCTT163469758TTCATTGACAACATTAAACAGCAATTAACTATTTGCTGATTACAT
Gorilla gorilla gorilla isolate Kamilah (stud number 0661) breed western lowland gorilla chromosome 4, Kamilah_GGO_v0, whole genome shotgun sequence.
taxonomy:"9595", bioproject:"PRJNA564096", refseq:"NC_044606.1"
NC_044606.1:179221324-179221338
TTTGGACCCCCAAATCAGTCTTCATATTCT179221324TTCATTGACAACATTCATTAAGTTCTGCAGAAATTAAATAGAATT
Gorilla gorilla gorilla isolate Kamilah (stud number 0661) breed western lowland gorilla chromosome 6, Kamilah_GGO_v0, whole genome shotgun sequence.
taxonomy:"9595", bioproject:"PRJNA564096", refseq:"NC_044608.1"
NC_044608.1:59799336-59799350
CTATTTCAATCAACCATCTTGTAATCATAC59799336TTCATTGACAACATTTTACTCATACTATAATAAGTTGCTATTTCT
Gorilla gorilla gorilla isolate Kamilah (stud number 0661) breed western lowland gorilla chromosome 7, Kamilah_GGO_v0, whole genome shotgun sequence.
taxonomy:"9595", bioproject:"PRJNA564096", refseq:"NC_044609.1"
NC_044609.1:4254066-4254080
GTGGTGCCTGGCCTGAGTCAGCACGTTAGC4254066TTCATTGACAACATTGGTTCGTTCAACAAATATTGCCTGAGAAGA
Gorilla gorilla gorilla isolate Kamilah (stud number 0661) breed western lowland gorilla chromosome 7, Kamilah_GGO_v0, whole genome shotgun sequence.
taxonomy:"9595", bioproject:"PRJNA564096", refseq:"NC_044609.1"
NC_044609.1:93234664-93234678
TATATTTGTTGTAGAATATTATGTTAAATC93234664TTCATTGACAACATTAAAGAGTCATACCTTTTATGGGTGTTAGTT
Gorilla gorilla gorilla isolate Kamilah (stud number 0661) breed western lowland gorilla chromosome 11, Kamilah_GGO_v0, whole genome shotgun sequence.
taxonomy:"9595", bioproject:"PRJNA564096", refseq:"NC_044613.1"
NC_044613.1:13770258-13770272
TTGAGTTTCCTGGAACATAGATATGTCTTG13770258TTCATTGACAACATTCTAGCATTGAGGACAATGAATAGAGCAAAG
Gorilla gorilla gorilla isolate Kamilah (stud number 0661) breed western lowland gorilla chromosome 13, Kamilah_GGO_v0, whole genome shotgun sequence.
taxonomy:"9595", bioproject:"PRJNA564096", refseq:"NC_044615.1"
NC_044615.1:63909678-63909692
GCAGTCTGGAGGTTCTCCCTGGAGGCTGTA63909678TTCATTGACAACATTGCCTGAGGTAACTCACACTGAGGTGACAAC
Gorilla gorilla gorilla isolate Kamilah (stud number 0661) breed western lowland gorilla chromosome 17, Kamilah_GGO_v0, whole genome shotgun sequence.
taxonomy:"9595", bioproject:"PRJNA564096", refseq:"NC_044619.1"
NC_044619.1:81030477-81030491
CCTGGGTATAATGCACTGACCTGCTGATCT81030477TTCATTGACAACATTGCCATCGACTTTGGAGCTGGAAAGGCCCTC
Gorilla gorilla gorilla isolate Kamilah (stud number 0661) breed western lowland gorilla chromosome 18, Kamilah_GGO_v0, whole genome shotgun sequence.
taxonomy:"9595", bioproject:"PRJNA564096", refseq:"NC_044620.1"
NC_044620.1:23044369-23044383
ATATTTATATATGTATATATTTCATATCAT23044369TTCATTGACAACATTTACTTGGGAGATTTGTCTCAACAAAAATTA
Pan paniscus isolate Mhudiblu (Carbone #601152) chromosome 2B, Mhudiblu_PPA_v0, whole genome shotgun sequence.
taxonomy:"9597", bioproject:"PRJNA633582", refseq:"NC_048241.1"
NC_048241.1:47662695-47662709
ATTGCAGCAAAGAAGCACATTTATATTCTA47662695TTCATTGACAACATTAGCATATAATGCAAATTTACTTTGGAACTT
Pan paniscus isolate Mhudiblu (Carbone #601152) chromosome 3, Mhudiblu_PPA_v0, whole genome shotgun sequence.
taxonomy:"9597", bioproject:"PRJNA633582", refseq:"NC_048242.1"
NC_048242.1:84661478-84661492
TTGATTTTGTATATATTAAATAGTTGAAAC84661478TTCATTGACAACATTAAATTTGTTTTCTAGGCTCTATTGGGGTAA
Pan paniscus isolate Mhudiblu (Carbone #601152) chromosome 4, Mhudiblu_PPA_v0, whole genome shotgun sequence.
taxonomy:"9597", bioproject:"PRJNA633582", refseq:"NC_048243.1"
NC_048243.1:10560924-10560938
AATGAAAGGCGTTTGAGGAAAGCCTGATAA10560924TTCATTGACAACATTACCATCAGCCACACCTTATCATTCCTAGCA
Pan paniscus isolate Mhudiblu (Carbone #601152) chromosome 4, Mhudiblu_PPA_v0, whole genome shotgun sequence.
taxonomy:"9597", bioproject:"PRJNA633582", refseq:"NC_048243.1"
NC_048243.1:141248538-141248552
CAGAATATATTATCGCTTTAAACACAGATT141248538TTCATTGACAACATTTTGTGGGCACCCATTTAATATTAATATTAA
Pan paniscus isolate Mhudiblu (Carbone #601152) chromosome 4, Mhudiblu_PPA_v0, whole genome shotgun sequence.
taxonomy:"9597", bioproject:"PRJNA633582", refseq:"NC_048243.1"
NC_048243.1:157997266-157997280
AAAAACCTCTGATTTTGTGTAACACTCCTT157997266TTCATTGACAACATTAAACAGCAATTAACTATTTGCTGATTACAT
Pan paniscus isolate Mhudiblu (Carbone #601152) chromosome 6, Mhudiblu_PPA_v0, whole genome shotgun sequence.
taxonomy:"9597", bioproject:"PRJNA633582", refseq:"NC_048245.1"
NC_048245.1:59671491-59671505
CTATTTCAATCAACCATCTTGTAATCATAC59671491TTCATTGACAACATTTTACTCATACTATAATAAGTTGCTATTTCT
Pan paniscus isolate Mhudiblu (Carbone #601152) chromosome 7, Mhudiblu_PPA_v0, whole genome shotgun sequence.
taxonomy:"9597", bioproject:"PRJNA633582", refseq:"NC_048246.1"
NC_048246.1:3780461-3780475
GTGGTGCCTGGCCTGAGTCAGCTCAGTAGC3780461TTCATTGACAACATTGGTTCGTTTAACAAATATTGCCTGAGAAGA
Pan paniscus isolate Mhudiblu (Carbone #601152) chromosome 8, Mhudiblu_PPA_v0, whole genome shotgun sequence.
taxonomy:"9597", bioproject:"PRJNA633582", refseq:"NC_048247.1"
NC_048247.1:30815751-30815765
ATATTTTTAAATTCATCAATATTTCCACTT30815751TTCATTGACAACATTATTAAGTTTTATTGTGCCTCTTTTTCCAAA
Pan paniscus isolate Mhudiblu (Carbone #601152) chromosome 11, Mhudiblu_PPA_v0, whole genome shotgun sequence.
taxonomy:"9597", bioproject:"PRJNA633582", refseq:"NC_048250.1"
NC_048250.1:24492483-24492497
TTGAGTTTCCTGGAACATAGATATGTCTTG24492483TTCATTGACAACATTCTAGCATTGAGGACAGTGAATAGAGCAAAG
Pan paniscus isolate Mhudiblu (Carbone #601152) chromosome 12, Mhudiblu_PPA_v0, whole genome shotgun sequence.
taxonomy:"9597", bioproject:"PRJNA633582", refseq:"NC_048251.1"
NC_048251.1:21317755-21317769
TAATTCTAATGTGTTGAAGTCCTTTAATCA21317755TTCATTGACAACATTATCCACCAATTCATTTGCAAAGCAGATTGG
Pan paniscus isolate Mhudiblu (Carbone #601152) chromosome 13, Mhudiblu_PPA_v0, whole genome shotgun sequence.
taxonomy:"9597", bioproject:"PRJNA633582", refseq:"NC_048252.1"
NC_048252.1:65390737-65390751
GCAGTCTGGAGGTTCTCCCTGGAGGCTGTA65390737TTCATTGACAACATTGCCTGAGGTAACTCACACTGAGGTGACAAC
Pan paniscus isolate Mhudiblu (Carbone #601152) chromosome 18, Mhudiblu_PPA_v0, whole genome shotgun sequence.
taxonomy:"9597", bioproject:"PRJNA633582", refseq:"NC_048257.1"
NC_048257.1:22831162-22831176
ATATTTATATATGTATATATTTCATATTAT22831162TTCATTGACAACATTTACTTGGGAGATTTGTCTCAACAAAAATTA
Pan paniscus isolate Mhudiblu (Carbone #601152) chromosome 19, Mhudiblu_PPA_v0, whole genome shotgun sequence.
taxonomy:"9597", bioproject:"PRJNA633582", refseq:"NC_048258.1"
NC_048258.1:38071958-38071972
AAGCCACCACACCCAGCCTATCTTAGCTTT38071958TTCATTGACAACATTAGTATAATGTTAACAGCTCTCCTAAGGGAG
Pan troglodytes isolate Yerkes chimp pedigree #C0471 (Clint) chromosome 2B, Clint_PTRv2, whole genome shotgun sequence.
taxonomy:"9598", bioproject:"PRJNA10627", refseq:"NC_036881.1"
NC_036881.1:46951208-46951222
ATTGCAGCAAAGAAGCACATTTATATTCTA46951208TTCATTGACAACATTAGCATATAATGCAAATTTACTTTGGAACTT
Pan troglodytes isolate Yerkes chimp pedigree #C0471 (Clint) chromosome 3, Clint_PTRv2, whole genome shotgun sequence.
taxonomy:"9598", bioproject:"PRJNA10627", refseq:"NC_036882.1"
NC_036882.1:85110203-85110217
TTGATTTTGTATACATTAAATAGTTGAAAC85110203TTCATTGACAACATTAAATTTGTTTTCTAGGCTCTATTGGGGTAA
Pan troglodytes isolate Yerkes chimp pedigree #C0471 (Clint) chromosome 4, Clint_PTRv2, whole genome shotgun sequence.
taxonomy:"9598", bioproject:"PRJNA10627", refseq:"NC_036883.1"
NC_036883.1:146950506-146950520
CAGAATATATTATCGCTTTAAACACAGATT146950506TTCATTGACAACATTTTGTGGGCACCCATTTAATATTAATATTAA
Pan troglodytes isolate Yerkes chimp pedigree #C0471 (Clint) chromosome 4, Clint_PTRv2, whole genome shotgun sequence.
taxonomy:"9598", bioproject:"PRJNA10627", refseq:"NC_036883.1"
NC_036883.1:163704653-163704667
AAAAACCTCTGATTTTGTGTAACACTCCTT163704653TTCATTGACAACATTAAACAGCAATTAACTATTTGCTGATTACAT
Pan troglodytes isolate Yerkes chimp pedigree #C0471 (Clint) chromosome 6, Clint_PTRv2, whole genome shotgun sequence.
taxonomy:"9598", bioproject:"PRJNA10627", refseq:"NC_036885.1"
NC_036885.1:59375838-59375852
CTATTTCAATCAACCATCTTGTAATCATAC59375838TTCATTGACAACATTTTACTCATACTATAATAAGTTGCTATTTCT
Pan troglodytes isolate Yerkes chimp pedigree #C0471 (Clint) chromosome 7, Clint_PTRv2, whole genome shotgun sequence.
taxonomy:"9598", bioproject:"PRJNA10627", refseq:"NC_036886.1"
NC_036886.1:3685889-3685903
GTGGTGCCTGGCCTGAGTCAGCTCAGTAGC3685889TTCATTGACAACATTGGTTCGTTTAACAAATATTGCCTGAGAAGA
Pan troglodytes isolate Yerkes chimp pedigree #C0471 (Clint) chromosome 8, Clint_PTRv2, whole genome shotgun sequence.
taxonomy:"9598", bioproject:"PRJNA10627", refseq:"NC_036887.1"
NC_036887.1:31412500-31412514
ATATTTTTAAATTCATCAATATTTCCACTT31412500TTCATTGACAACATTATTAAGTTTTATTGTGCCTCTTTTTCCAAA
Pan troglodytes isolate Yerkes chimp pedigree #C0471 (Clint) chromosome 13, Clint_PTRv2, whole genome shotgun sequence.
taxonomy:"9598", bioproject:"PRJNA10627", refseq:"NC_036892.1"
NC_036892.1:65421923-65421937
GCAGTCTGGAGGTTCTCCCTGGAGGCTGTA65421923TTCATTGACAACATTGCCTGAGGTAACTCACACTGAGGTGACAAC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/togogenome/TTCATTGACAACATT
lang : en | db : togogenome | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.009 | 0.009 | search_start;
0.134 | 0.125 | search_plus_done; http://172.18.8.71:27910/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.432 | 0.298 | search_minus_done; http://172.18.8.71:27910/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=0
0.432 | 0.000 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).