GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2021-03-07 17:56:53, GGGenome : Manatee genome, Broad v1.0/triMan1 (Oct, 2011)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

JH594637:19936062-19936076
GATCAGAGAGAGAGATCTTTTTGAAGGTAA19936062TTCATTGACAACATTGTCCTATTTATTTGCTAGTTGTGGGACTAT
JH594642:15980732-15980746
ATTGCAACAAACTAGCATACGTACACTCTA15980732TTCATTGACAACATTAGCATATAATATGAGTTTATTTTAGAACTT
JH594653:3242792-3242806
TGATTTGCTTGCTGTATCCCCCATAATCGA3242792TTCATTGACAACATTTATTTGTGTATCCCTGATGGGCTGCATATT
JH594656:6178757-6178771
TCAAAACATGTTTATTTTCCTTAAATGATA6178757TTCATTGACAACATTTGACTCTTGTGCAAAAATGCAAAAATATCA
JH594659:11209269-11209283
AACGCTGCTGGGGGCAGTGGGTCACTCTCT11209269TTCATTGACAACATTGACCATGGGGTAGATTTAACCAAGGCCACT
JH594663:1770375-1770389
CCTGTTTTCTGGGGCCACTTCTGGGCGTGC1770375TTCATTGACAACATTTTACAGATGAAGAAACTGAGCCTCAAGGAG
JH594715:7253222-7253236
AATAAAACCAAATTAAGAGGCTCTGTAATT7253222TTCATTGACAACATTCTGCATACAATAGAATATTACTACACATGA
JH594785:374978-374992
CCTACCACAACATCTCTTCCCAACTTTGTG374978TTCATTGACAACATTGGTAGCTGCAAATCAACCATGGTGGGAGTG
JH594618:26161228-26161242
TCCTCCTCAAATTACTAAATTAGATGCTAT26161228AATGTTGTCAATGAATGTATTCAGATTTGATGGACAGTTTCTCAA
JH594638:19774396-19774410
GAACAGTGGAAACGAGCTATGGATTATTTA19774396AATGTTGTCAATGAACTCAACTACATGACTCAGATTGTTATCATG
JH594778:3473747-3473761
ACTGTTCATTTCTGTACTTCTTAGTGATAA3473747AATGTTGTCAATGAAGTACATTCTTGATTTTAGTAATTTAAAAAC

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/triMan1/TTCATTGACAACATT
lang : en | db : triMan1 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.007 | 0.007 | search_start;
0.089 | 0.082 | search_plus_done; http://172.18.8.78:28040/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.095 | 0.006 | search_minus_done; http://172.18.8.78:28040/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=42
0.096 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).