GGGenome Help | Japanese

Database:

Max number of mismatches/gaps mismatches : (no more than 25% of the query length)
Search for: both strand plus strand minus strand

2022-12-06 09:44:04, GGGenome : Dolphin genome, Baylor Ttru_1.4/turTru2 (Oct, 2011)

Summary:

Results:

Matches are highlighted with blue background. Mismatches and indels are marked in red.

JH473682:158720-158734
TGATGTTACCGTGGTTGTTGTTTTATCTAC158720TTCATTGACAACATTTAAGATTTCCAACTTCTCTTGACCCCAGAG
JH476472:1634-1648
TTGTTTAGTCTTATAAAACTAGATTGCTAT1634TTCATTGACAACATTGTCAAAAGTGAATGAAGACTGACACCATAA
JH478582:48636-48650
CTAGAATATATTATCGCTTAAACACAGATT48636TTCATTGACAACATTCTGTGGGCATTCATTTAATATTAATATCAA
JH479831:38175-38189
GCAAAGAATCCATGCTTAAAATATAACAAT38175TTCATTGACAACATTTTAAAATTTTGTTTTAAAATTTAATACCAA
JH484971:64571-64585
CTCTTTAATTTGTAACTCAATTAAAATTAA64571TTCATTGACAACATTACTCCTTTGCCTAGATAGGGCTAAGTGGGA
JH488496:31628-31642
TCTAGCTAGTTAAGATCATGAATGGCCATT31628TTCATTGACAACATTCTGATTTCCCAGTATATCTGATTCAAGATA
JH497216:16612-16626
TGGCCTCATTTTTGTAAGTAAGTAAATATA16612TTCATTGACAACATTAATGGTGGATAGCTCTGGGTAGTGGAGTTG
JH499859:6158-6172
GAAACAAAGGTCAGAGTTTAAGGAAATTAC6158TTCATTGACAACATTCAATATTTACTACATTTCAACTTTATTCTG
ABRN02220311:433-447
AGTATGCTGCACTCCAAATACTATTGTGTT433TTCATTGACAACATTCACTATTACATATGCATGTGAAAAACAGGC
JH472798:175782-175796
TTGAATTAGGATTCCTGTATGCCAGTATGG175782AATGTTGTCAATGAAGTCATTTTAGTTTTTAAGAAACNNNNNNNN
JH475584:82950-82964
ATATTATGTCATGCACTAGTGAGAGGAAAA82950AATGTTGTCAATGAAATTATGACATGCTATTGACCATAAGATGCA
JH485934:8164-8178
TAAATCTTATTTTTAACATTGCCCTGCTTA8164AATGTTGTCAATGAATATCATTAGTCCTCAAGATAAAGTACAAAC
JH487416:15784-15798
GAGATCAGTGCAAAAATATGAGCATTTAAA15784AATGTTGTCAATGAATATCTTAGAATATTATAAGATACATTATTT
JH492576:34349-34363
TATATAAATTGGAAAGCTTCAAATAAAAAA34349AATGTTGTCAATGAAATCTCTTAGAAACCAATGCAAATCTACTTG
ABRN02039883:462-476
TTAAAATTTAAAAGAATGTATAATTTCCAA462AATGTTGTCAATGAATATAAAATAAACTTCCATAGTCATAAGAAG

Data Export:

Maximum 100000 results can be retrieved in various formats shown below:

Debug Info:

Redirect URI : http://gggenome.dbcls.jp/turTru2/TTCATTGACAACATT
lang : en | db : turTru2 | k : 0 | strand : | nogap : | query_string : TTCATTGACAACATT | format : html | download : | debug :

0.008 | 0.008 | search_start;
0.087 | 0.079 | search_plus_done; http://172.18.8.78:28031/match?q=TTCATTGACAACATT&k=0&no_gap=0&offset=0&limit=50
0.098 | 0.011 | search_minus_done; http://172.18.8.78:28031/match?q=AATGTTGTCAATGAA&k=0&no_gap=0&offset=0&limit=41
0.099 | 0.001 | cgi_end;

GGGenome by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).